Back Pain

 

This Article For Authors Learn More Submit
Journal of Orthopaedic Research
. 2018 Feb; 36(2): 778–787.
Published online 2017 Oct 17. doi: 10.1002/jor.23713
PMCID: PMC5873378
PMID: 28851112

Dynamic imaging demonstrates that pulsed electromagnetic fields (PEMF) suppress IL-6 transcription in bovine nucleus pulposus cells

1 Department of Orthopaedic Surgery, University of California San Francisco, San Francisco, California,
2 Orthofix Inc., Lewisville, 75056, Texas,
Jeffrey C. Lotz, ude.fscu@ztol.yerffej.
corresponding authorCorresponding author.
*Correspondence to: Jeffrey C. Lotz (T: +415?476?7881; F: (415?476?1128; E?mail: ude.fscu@ztol.yerffej)
Received 2017 Apr 7; Accepted 2017 Aug 19.
This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Associated Data

Supplementary Materials

ABSTRACT

Inflammatory cytokines play a dominant role in the pathogenesis of disc degeneration. Pulsed electromagnetic fields (PEMF) are noninvasive biophysical stimulus that has been used extensively in the orthopaedic field for many years. However, the specific cellular responses and mechanisms involved are still unclear. The objective of this study was to assess the time?dependent PEMF effects on pro?inflammatory factor IL?6 expression in disc nucleus pulposus cells using a novel green fluorescence protein (GFP) reporter system. An MS2?tagged GFP reporter system driven by IL?6 promoter was constructed to visualize PEMF treatment effect on IL?6 transcription in single living cells. IL?6?MS2 reporter?labeled cells were treated with IL?1? to mimic the in situ inflammatory environment of degenerative disc while simultaneously exposed to PEMF continuously for 4?h. Time?lapse imaging was recorded using a confocal microscope to track dynamic IL?6 transcription activity that was demonstrated by GFP. Finally, real?time RT?PCR was performed to confirm the imaging data. Live cell imaging demonstrated that pro?inflammatory factor IL?1? significantly promoted IL?6 transcription over time as compared with DMEM basal medium condition. Imaging and PCR data demonstrated that the inductive effect of IL?1? on IL?6 expression could be significantly inhibited by PEMF treatment in a time?dependent manner (early as 2?h of stimulus initiation). Our data suggest that PEMF may have a role in the clinical management of patients with chronic low back pain. Furthermore, this study shows that the MS2?tagged GFP reporter system is a useful tool for visualizing the dynamic events of mechanobiology in musculoskeletal research. © 2017 The Authors. Journal of Orthopaedic Research® Published by Wiley Periodicals, Inc. on behalf of Orthopaedic Research Society. J Orthop Res 35:778–787, 2018.

Keywords: MS2?GFP reporter, dynamic imaging, pulsed electromagnetic fields, IL?6 mRNA expression, spine/disc biology

Intervertebral disc (IVD) degeneration is ubiquitous in the adult population and associates with back pain?related disabilities.1 Low back pain causes more disability globally than any other conditions, and creates a significant financial burden on the worldwide health care system (>$100 billion per year).23 Disc degeneration occurs when undesired cell behaviors, particularly the imbalanced secretion of the anabolic, and catabolic factors, triggers degradation of extracellular matrix, leading to a series of inflammatory responses and further cell dysfunction.4567 Due to the disc’s poor capability of self?regeneration, many strategies have been developed to promote tissue repair that include stem cell, growth factor, and biomaterial approaches.89 Unfortunately, these approaches have not yet been successfully translated to the clinic, likely because the microenvironment within degenerated disc hinders their therapeutic effects. Therefore, there is a pressing need for therapeutic approaches that reestablish tissue homeostasis and reverse the catabolic cell behaviors underlying painful disc degeneration.

Pro?inflammatory cytokines and inflammatory mediators play crucial roles in the initiation and progression of disc degeneration. These include interleukins (IL?1, IL?2, IL?6, IL?8, and IL?17), interferon gamma (IFN??), TNF??, nitric oxide (NO), and prostaglandin E2 (PGE2),101112 which are elevated in the degenerated NP and annulus fibrosus (AF), and associate with matrix degradation.1213 Among these factors, IL?1 plays a predominant role by up?regulating the expression of IL?6, IL?17, MMP3/13, ADAMTSs, iNOS, Cox?2, PGE2, and by inhibiting anabolic factor production.11121415161718Ultimately, these undesired cell behaviors frustrate therapeutic strategies for disc regeneration.

PEMF is a noninvasive biophysical stimulation that has been used clinically for enhancing bone healing and treating failed fusions, pseudoarthrosis, and osteoporosis.1920212223 Positive clinical outcomes have inspired researchers to explore PEMF mechanisms so as to further optimize current treatments and expand clinical indications. Recently, several in vitro studies have shown that PEMF could promote cartilage and bone metabolism by stimulating chondrocyte/osteoblast/tendon cell proliferation and differentiation, and by positively modulating matrix synthesis.242526272829 Additionally, PEMF has been implicated in inflammatory response modulation. For example, PEMF treatment can reduce the secretion of pro?inflammatory cytokine IL?1? and TNF?? in fibroblast?like cell, decrease IL?6/IL?8 release in lymphocytes from rheumatoid arthritis patient,3031 inhibit PGE2, and vascular endothelial growth factor (VEGF) secretion in chondrocytes,32 promote anti?inflammatory cytokine factors release, and preserve cartilage/disc tissue from detrimental environment of high inflammatory cytokine levels during degeneration.30323334 Taken together, these studies suggest that an important therapeutic activity of PEMF is the regulation of cell inflammatory behaviors. Our previous study indicated that PEMF stimulation could significantly reduce pro?inflammatory cytokine IL?6 expression in the presence of IL?1a in human degenerated disc cells at day 4.35 This was the first evidence that PEMF can modulate acute inflammatory behaviors of disc cells that associate with chronic discogenic back pain. However, the temporal and spatial resolution of cellular responses and molecular events involved with PEMF are still poorly understood. Moreover, the underlying mechanisms of PEMF action remains unclear. Studying these cellular and molecular responses will help to elucidate mechanism and optimize PEMF treatment conditions such as pulse intensity, frequency, and dosing time to maximize clinical benefits.

For evaluating the dynamic effect of PEMF on IL?6 transcription, a newly developed technology, GFP?tagged MS2 reporter system,3637383940 was adopted to visualize in real time the transactivation of the IL?6 gene through tracking GFP produced in single living cells in vitro. This technology allows a GFP?MS2 fusion protein (expressed by the first plasmid) to specifically bind to the RNA motif containing MS2 repeat sequence (expressed by the second plasmid), therefore resulting in an amplified, bright green fluorescent particles in cells (Fig. ?(Fig.1).1). By visualizing the bright GFP particle activity, dynamic transactivation of a specific mRNA can be traced within the cell. This system has been confirmed by many in vitro studies, and has even been applied in vivo.373841424344 In the present study, MS2?tagged GFP system was the first time applied in musculoskeletal tissues to visualize and evaluate dynamic effects of PEMF treatment on IL?6 transcriptional activity in bovine NP cells. The data will help to optimize PEMF treatment conditions therefore benefit clinical treatment.

An external file that holds a picture, illustration, etc. Object name is JOR-36-778-g002.jpg

Schematic of MS2 constructs used in this study. Plasmid A) PGK?MS2?GFP fusion protein Plasmid, expresses the MS2?GFP fusion protein; Plasmid B) reporter mRNA, expresses an MS2?×?24 repeat sequence driven by IL?6 promoter (IL?6?RFP?MS2). Single transfected cells (Plasmid A, left side) showed a diffuse green fluorescence concentrated within the cell nucleus because of the nuclear localization sequence (NLS); In co?transfected cells (right side), the fusion protein co?expresses with the reporter mRNA containing MS2?binding sites. The fusion protein specifically binds to one of the 24 copies of the RNA motif contained in the MS2?×?24 repeat sequence. The resultant binding of multiple copies of the MS2?GFP fusion protein to the mRNA forms bright green particles in cells (particularly induced by pro?inflammatory factor IL?1?).

METHODS

The GFP?MS2 and Reporter Expressing Vectors

Two key constructs were used in this study: Plasmid A is an MS2?GFP fusion protein (PGK?MS2?GFP). Plasmid B is a reporter mRNA (IL?6?RFP?MS2?×?24 binding sites). Together they comprise a novel application of the previously described MS2?tagged GFP system, adapted here to evaluate the dynamic regulation of IL?6.38394344 Plasmid A: the MS2?GFP fusion construct was made by excising the MS2?GFP?NLS from pMS2?GFP (Addgene, Cambridge, MA) with Nhel and Clal sites and ligating in between NotI and HindIII sites of p miniTol2 (Addgene). Plasmid B: the mRNA reporter construct was generated by ligating IL?6 promoter?RFP?MS2?×?24 in between NotI and HindIII sites of p miniTol2 (Addgene). MS2?×?24 sequence was synthesized by Invitrogen (CA). The two constructs were validated via gene sequencing (MCLab, CA). In this reporter system, the fluorescent signal is amplified through recruitment of the MS2?GFP fusion protein to the 24 MS2?binding motifs in the reporter mRNA, which is expressed under control of the IL?6 promoter. When bound to the reporter, the MS2?GFP fusion protein forms bright nuclear GFP particles, such that the number and intensity of fluorescent particles corresponds to the level of IL?6 mRNA induction. The schematics of constructs are described in Figure ?Figure11.

Cell Culture and Transfection

IVDs were harvested from bovine caudal spines (18–24 month old). The discs were dissected and separated into zones of annulus fibrosis (AF) and nucleus pulposus (NP) according to their distinct morphological appearance where AF is a highly dehydrated lamellar structure while NP is a gelatinous structure. After digestion in a protease/collagenase cocktail overnight, retrieved NP cells were suspended in Basal Media (low?glucose Dulbecco’s Modified Eagle’s media (DMEM) (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 5% fetal bovine serum (FBS, HyClone, South Logan, UT), non?essential amino acids solution (Invitrogen), antibiotic/antimycotic (100?U/ml penicillin, 100??g/ml streptomycin, and 0.25??g/ml fungizone, Invitrogen), 1.5% osmolarity salt solution (containing 5?M NaCl and 0.4?M KCl, Sigma, St. Louis, MO). Cells were cultured in an incubator at 37°C with 5% CO2 and 95% humidity, and expanded to passage two for these experiments.

Transfections were performed with electroporation (10?ug DNA, Neon® Transfection System, Life Technologies) when cells reached 70–80% confluence.

Flow Cytometry

To verify the MS2?GFP reporter system, flow cytometry was used to detect the expression of red fluorescence protein (RFP) and GFP. Cells were transfected with either of the two plasmids (pMS2?GFP or pIL?6?RFP?MS2?×?24) alone or in combination. After culture for 36?h trypsinized cells were used to quantify the expression of GFP and RFP. Unlabeled cells were chosen as a negative control for gating the target cell population base on cell size, shape and optical homogeneity, and setting the fluorescence threshold for quantifying positive cells (GFP and RFP positive). The percentage of fluorescence?positive cells and mean fluorescence intensity (MFI) were analyzed using a BD Fortessa flow cytometer at 488 and 561?nm wavelength. Each group has three biological replicates for flow cytometry analysis.

Pulse Electronic Magnetic Field (PEMF) Setting

The PEMF device used in this study has similar waveform parameters as the clinically?approved Physio?Stim® PEMF device for treatment of long bone non?unions (Orthofix Inc., Lewisville, TX). Specifically the electromagnetic waveform was a triangular wave with a 25% duty cycle, 3,850?Hz pulse frequency,15?Hz burst frequency, and maximum 10?T/s rate of change. The PEMF exposure system itself consisted of a coil fitted to a confocal microscope, with a diameter large enough to hold a 35?mm diameter dish during exposure. To ensure uniform exposure a dB/dt sensor was used to monitor the magnetic field during PEMF treatment.

Real?Time Reverse Transcription PCR

To understand cellular responses to PEMF, real time quantitative PCR (qRT?PCR) was used to assay gene expression after PEMF treatment. Cells grown in DMEM Basal Medium were divided into three groups: DMEM Basal Medium group, IL?1? treatment group (10?ng/ml), and IL?1? +PEMF treatment group. PEMF was turned on after 2?h of IL?1? treatment, and both PEMF and IL?1? were used continuously to treat cells for 4?h beyond that. Cell samples were collected at 1, 3, 4, 6, and up to 8?h after initiation of IL?1 ? treatment for RNA isolation and cDNA synthesis (Qiagen, Valencia, CA). cDNA was amplified with specific primers for bovine IL?6 (Forward: TGAGTGTGAAAGCAGCAAGGA; Reverse: TACTCCAGAAGACCAGCAGTGG) and GAPDH (Forward: GCCATCACTGCCACCCAGAA; Reverse: GCGGCAGGTCAGATCCACAA) using the iQ SYBR Green Supermix kit (BioRad, Hercules, CA). Real time PCR was performed with the iCycler iQ system (BioRad, Hercules). Bovine GAPDH was selected as the internal reference. Each group has three biological replicates, each of which had three technical replicates. Relative gene expression was determined using the delta?delta CT method.45

Confocal Microscopy, Live?Cell Imaging, and Analysis

For live imaging, transfected cells were cultured in 35?mm glass?bottom tissue–culture dishes (MatTek, Ashland, MA). The glass bottom was pre?coated with collagen type I solution, 50??g/ml (BD Bioscience, Tewksbury, MA) at 4°C overnight. Transfected cells were cultured for 36–40?h prior to imaging using confocal laser point scanning microscope (Leica, TCS SP5, Mannheim, Germany). To maintain 37°C, 5% CO2, and 95% humidified atmosphere throughout imaging, the microscope was equipped with a temperature control cube (Life Imaging Services, Basel, Switzerland), with CO2 and humidity control (OkoLab, Pozzuoli, NA, Italy). Time?lapse imaging in four dimensions (X, Y, Z over time) was recorded with 12?bit camera at 400?HZ speed using a HC PL APO 63×/1.40 objective (Leica, Mannheim, Germany). GFP fluorescence was detected using an Argon Laser (488?nm, 20% output) with 8–10% laser power. Mark and Find function was used to record multiple cell positions every half hour, and the z?slice thickness was maintained at ?0.5??m. During imaging, cells were treated with DMEM media with or without IL?1? (10?ng/ml, GenScript, NJ) for 2?h prior to administration of PEMF for 4?h (IL?1? was present together with PEMF during the whole experiment).

Imaris software (Bitplane, MA) was used to analyze the images captured on the confocal microscope. With the tracking module of Imaris, the GFP particles within a 3D volume of the cells were counted, tracked, and analyzed according to the threshold of particle size (0.5??m) and of intensity.

Statistical Analysis

Statistical differences were tested using a one?way analysis of variance (ANOVA), followed by Fisher’s PLSD for comparing multiple groups. All analyses were performed using StatView 5.0 (SAS institute, Inc. Cary, NC). Data are depicted as mean?±?95% confidence intervals, and p?values less than 0.05 were considered significant.

Biological replicates represent unique bovine tails. Three biological replicates were used for flow cytometry and PCR studies. Technical replicates for RNA represent unique wells of cells in independent experiments as well as triplicate wells in qPCR analysis. For imaging, only one tail was used. At least three independent experiments were performed for each group and technical replicates (n?=?9) represent the cells.

RESULTS

Inductive Effects of Pro?Inflammatory Cytokine IL?1? on IL?6 Gene Expression

Expression of IL?6 in bovine nucleus pulpous cells was measured using real?time qRT?PCR. In basal medium, IL?6 expression was low over time in NP cells (Fig. ?(Fig.6).6). However, after IL?1? treatment, IL?6 expression significantly increased in a time?dependent manner from 3?h (p?=?0.07) to 8?h (p?<?0.01). Note: The time points mean the time after initiation of IL?? treatment.

An external file that holds a picture, illustration, etc. Object name is JOR-36-778-g007.jpg

Real time RT?PCR validation for PEMF and IL?1 ? treatment effects. # represents p?=?0.07; ** represents p?<?0.01. n?=?3 for biological replicates and n?=?3 technical replicates.

Expression of the MS2?GFP Reporter in Nucleus Pulposus Cells

The effect of IL?1? on IL?6 expression inspired us to trace the dynamic expression of IL?6. When transfected only with Plasmid A, the MS2?GFP fusion protein is confined to the nucleus because of the nuclear?localization sequence in MS2?GFP fusion protein. When Plasmid A is cotransfected with Plasmid B, some bright green GFP particles are apparent due to the specific recruitment of the MS2?GFP fusion protein to the binding sites upon basal expression of the mRNA reporter (Fig. ?(Fig.1;1; Fig. ?Fig.2A).2A). After induction by IL?1? treatment (“IL?6 ON”) compared with “OFF” state (without IL?1?), many more bright green GFP particles were rapidly produced (Fig. ?(Fig.2A2).2A2). These GFP particles were distributed within both the nucleus and cytoplasm (Fig. ?(Fig.2B).2B). Of these, particles with the strongest intensity were found in the nucleus due to the accumulation of enriched GFP molecule in the nucleus. Therefore, GFP?bound mRNA presented as bright green particles interspersed within a diffuse, lower intensity signal in cells (Fig. ?(Fig.2A2),2A2), which is similar to the data reported in previous studies.373843444647 Interestingly, the particle shape is not uniform in our study. Most of them had a regular round shape, while some bigger and brighter particles with irregular shape were also observed in the cell (Fig. ?(Fig.2C).2C). These larger particles may contain multiple RNA molecules or multi?copies of GFP molecules. Thus for quantitative analysis, a threshold for the particle size and intensity was set up to gate single positive particles. White dots represent bright individual GFP particles (Fig. ?(Fig.2B),2B), that were tracked by Imaris software in terms of the particle number and intensity.

An external file that holds a picture, illustration, etc. Object name is JOR-36-778-g003.jpg

Visualization of dynamic mRNA expression in individual live cells. A1) Illustration of IL?6 expression ON and OFF in MS2?GFP system. A2) Single GFP particles in living cells after transfection. B) GFP particle distribution in single living cells after co?transfection (both in the cytoplasm and nucleus); White dots represent GFP particles that are tracked with Imaris software. C) Dynamic imaging of GFP in nucleus of living cells after co?transfection (induced by IL?1?) for 400?min. Exposure time is reduced to visualize the particulate nature of the intense nuclear stain.

Visualization of IL?6 Transcription Activity

By monitoring the accumulation and intensity of the MS2?GFP fusion protein particles, we can visualize dynamic activation of IL?6 transcription following IL?1? treatment in single cells with great sensitivity. As shown in Figure ?Figure3C,3C, IL?6 transactivation is evident within 60?min (started at 30?min, data is not shown) after IL?1? treatment, then the number of the GFP particles dramatically increase and then continue to accumulate throughout the whole imaging time (up to 400?min) without interruption.

An external file that holds a picture, illustration, etc. Object name is JOR-36-778-g004.jpg

Flow cytometry verifying the GFP and RFP profile in MS2?GFP fusion and mRNA reporter system. A) Control, without transfection. B) MS2?GFP fusion plasmid single transfection C) IL?6?RFP?MS2 plasmid single transfection D) Co?transfection (n?=?3/group). MFI?=?mean fluorescence intensity.

Verification of MS2?GFP System

To verify the MS2?GFP system, flow cytometry was used to detect the expression of RFP and GFP in NP cells after transfection (n?=?3). The RFP and GFP labeled cell populations were delineated with quadrants data (Fig. ?(Fig.4).4). About 4.7% of plasmid A?transfected cells were GFP?positive (Fig. ?(Fig.3B),3B), 2.1% of plasmid B?transfected cells were RFP?positive (Fig. ?(Fig.3C),3C), and 2% of co?transfected cells were double labeled with both RFP and GFP (Fig. ?(Fig.3D).3D). The intensity and number of GFP?positive cells were dramatically increased in the co?transfection group compared with the single transfection group (increased from 4.7%, MFI 1207 (Fig. ?(Fig.3B)3B) up to 41.7%, MFI 2575 (Fig. ?(Fig.3D),3D), MFI?=?mean fluorescence intensity), which corresponded to the specific binding of MS2?GFP fusion protein to the MS2 mRNA repeat sequences, which amplifies the GFP signal. Flow cytometry data confirmed that RFP signals were detected both in IL?6?MS2 mRNA reporter transfected cells and co?transfected cells; interestingly, GFP signals were significantly amplified in co?transfected cells, which was consistent with the schematics and imaging data in Figures ?Figures11 and ?and22.

An external file that holds a picture, illustration, etc. Object name is JOR-36-778-g005.jpg

Dynamic images demonstrating the effects of IL?1? alone and IL???+?PEMF treatment on IL?6 expression. PEMF dosing started at 2?h after IL?1? treatment.

Dynamic Imaging of IL?1? and PEMF Effects on IL?6 Gene Transcription

Time?lapse imaging demonstrated the dynamic regulation of GFP particle number and intensity in response to IL?1? and PEMF treatment from 0?min to 6?h (Fig. ?(Fig.4).4). Three cells were selected as representative images of each the DMEM Basal Medium group, IL?1? treatment group, and IL?1??+?PEMF group, respectively. No bright GFP particles were found at the beginning of imaging in all cells (0?min) except for some diffuse green fluorescence in nucleus. Soon after IL?1? treatment, bright GFP particles appeared. Although the timing varies slightly among cells, this increase is consistently observed 30?min after IL?1? stimulation and continue to increase over time. In DMEM Basal Medium, the GFP levels representing IL?6 expression were obviously lower than in the IL?1? treated group throughout the experiment (Fig. ?(Fig.4).4). However, in the IL?1? treatment group, a dramatic increase was observed in both GFP intensity and particle number as early as 30?min. This signal peaks at about 1–2?h and is maintained for up to 6.5?h without interruption. As a result, the nucleus turned exceedingly green due to the aggregation of the bright GFP particles.

Interestingly, GFP expression showed a significant change after PEMF treatment. PEMF was applied 2?h after IL?1? induction. Prior to PEMF stimulation, IL?1? increased GFP particle levels to a peak at 2?h. Rapidly after PEMF treatment, MS2?GFP particle numbers and intensity rapidly returned to basal levels, with an initial decrease observed 30?min post?PEMF (around 2.5?h), and a sharp reduction apparent from 4 to 6?h.

Quantification of PEMF Treatment Effects on IL?6 Expression

The GFP particle number and intensity were tracked with the tracking module of Imaris software (n?=?9 for each group). Consistent with the qualitative analysis of the GFP images, this quantitative approach showed that IL?6 is expressed at a low basal level in the DMEM group, while it was activated significantly by IL?1? treatment within 30?min and peaked at about 1–2?h, then maintained to 6?h (p?<?0.01). However, the inductive effects of IL?1? were inhibited by PEMF treatment significantly as early as 2?h (p?<?0.01), and GFP particle number continuously decreased until 6.5?h. By 3.5?h, there was no significant difference between the IL?1??+?PEMF treated cells and the DMEM Basal Medium group (Fig. ?(Fig.5).5). The quantification results matched the imaging data shown in Figure ?Figure44.

An external file that holds a picture, illustration, etc. Object name is JOR-36-778-g006.jpg

Quantification of IL?1? and PEMF treatment effects by calculating GFP particle number over time (n?=?9/group). PEMF dosing started at 2?h after IL?1? treatment (blue arrow) and turned off at 6?h (red arrow). Significant differences between IL?1? and IL?1??+?PEMF group starts at 2hr (p?<?0.01). Loss of significance occurred between IL???+?PEMF and DMEM groups at 3.5?h (p?<?0.05).

Real?Time PCR Validation of PEMF Effects on IL?6 Expression Induced by IL?1?

To further verify these results, which are based on single cell dynamic imaging analysis, we assessed gene expression at the population level using qRT?PCR. IL?6 is expressed at low levels in DMEM Basal Medium within 48?h. After treatment with IL?1?, IL?6 expression tended to increase starting from 3?h (p?=?0.07) and continuously went up in a time?dependent manner over time (up to 8?h) (Fig. ?(Fig.6)6) (p?<?0.01). However, this inductive effect of IL?1? on IL?6 expression was significantly reduced around 8?h (p?<?0.01). PEMF treatment did not induce any pre?apoptosis cell response or toxic effects as detected in a live/dead assay.35

DISCUSSION

Pro?inflammatory cytokines play a predominant role during disc degeneration by inducing catabolic proteases, which drive extracellular matrix degeneration.67 We previously showed that IL?1? induces the expression of IL?6 and catabolic protease levels in nucleus pulpous cells in 3D culture, and PEMF treatment inhibited this upregulation induced by IL?1? after 4 days culture.35 These data suggested that PEMF can repress inflammatory responses that play a causal role in musculoskeletal tissue degeneration. To investigate the mechanisms of PEMF action in more detail, it is essential to understand the dynamic effects of PEMF on transcription with greater temporal and spatial resolution (Fig. ?(Fig.55).

In this current study, we present a validated MS2?GFP reporter system to dynamically visualize the regulation of IL?6 transcription under an inflammation and PEMF treatment conditions. This system detects the ability of IL?1? to rapidly trigger IL?6 transcription and to maintain this expression continuously over several hours, which is consistent with previous data that IL?1 could up?regulate IL?6 expression during disc degeneration735 as well as in the validation studies presented here (Figs. ?(Figs.22 and ?and4).4). This system also provides dynamic high?resolution insight into the effects of IL?1? and PEMF on IL?6 transactivation. Quantitative analysis of GFP particle number confirmed the imaging visualization (Fig. ?(Fig.5).5). Dynamic images illustrated the process that PEMF treatment rapidly repressed the inductive effects of IL?1? on IL?6 expression by decreasing GFP particle number as early as 0.5?h after PEMF dosing. It suggests that PEMF treatment regulates inflammatory responses associated with disc degeneration. Given the immediate early response of PEMF in repressing IL?6 transcription, it raises questions about the mechanisms of PEMF action. Future studies can explore those potential regulation of inflammatory pathways. For example, recent studies implicated NF?kappa B (NF?k?), p38 mitogen?activated protein kinase (MAPK), calcium ATPase or adenylate cyclase receptor, and nitric oxide signaling are involved in cartilage inflammation and skeletal tissue degeneration, which suggested that these pathways may potentially participate in the mechanism of PEMF action on inflammation.32334849 In addition, previous work showed that PEMF action increased basal levels of Ca2+ and calcineurin activity in osteoblasts.50 It is unclear if PEMF action would affect Ca2+ activity, which could potentially influence the MS2?GFP reporter system used in our current study. However, we do not expect that this is a problem since previous work has shown that the GFP?MS2 system is very stable owning to the strong and unique affinity between MS2 protein and the MS2 binding site. It would be interesting to elucidate the role of downstream effectors in PEMF treatment on disc inflammation in future studies. We are currently exploring the mechanisms of PEMF action, including the involvement of the NF? k?, MAPK, and Ca2 +signaling pathways. Furthermore, more and more studies have been trying to find the mechanical modulation of cell, tissue, and organ functions in the field of mechanobiology. The MS2?GFP reporter system is a promising tool that can be applied to visualize the dynamic modulation of mechanobiologic mechanisms in single living cells.

It is worth noting that, this novel IL?6 MS2?GFP reporter system can detect the effects of PEMF on IL6 expression more rapidly and with greater sensitivity than traditional approaches. It provided us a visualization of dynamic transactivation of IL?6 mRNA at temporal and spatial resolution in single living cells during IL?1? and IL?1??+?PEMF treatment. Compared with standard methods such as qRT?PCR or in situ hybridization that are limited to detect gene expression in cell population or fixed cells, the MS2?GFP reporter system could be invaluable in elucidating and quantifying the real time effects of PEMF treatment on inflammation. It could also be applied broadly in other cell types and in other clinical scenarios to investigate the dynamic regulation of IL?6 in many circumstances. However, there are some limitations about this system. It is difficult to monitor the particles both in the nucleus and cytoplasm simultaneously due to the extremely strong fluorescence intensity in the nucleus compared to the cytoplasm (Fig. ?(Fig.3B).3B). Therefore, the current experiment focused on nucleoplasm. We used the Mark and Find function of confocal microscope to select and measure as many cells as possible within a reasonable timeframe. It is hard to extract the whole cell information from multiple cells in a single image stack since the cells are not exactly at the same focal plane. Therefore, we did three experiment replicates to minimize the potential source bias. Additionally, the signal for RFP (red fluorescent protein) that was used to screen positive cells in the IL?6?MS2 mRNA reporter, unfortunately, was too weak to be observed with microscopy. It could be that the intensity of a single RFP molecule is weak, and it does not have the accumulative or amplified effect observed for GFP when GFP?MS2?binding sites group after the transcripts are transported back to nucleus. Furthermore, singly transfected cells did not show a very high intensity owing to the single molecule GFP or RFP. For that reason, flow cytometry was performed to validate the reporter system instead, which demonstrated the effectiveness of the reporter system used in our study. Due to the large plasmid size and the unsynchronized primary cells, the transfection efficiency was not high. However, the consistent positive population in multiple replicates in this experiment supported the stability and effectiveness of this system during these experiments. Also, in this system, the non?uniform distribution of RNA molecules which form GFP particles and the changing focal plane of particle location and unsynchronized primary cells may cause variations of the particle number and intensity among individual cells in imaging. Although variations existed in the exact time up? or down?regulation, both PCR and imaging demonstrated that PEMF treatment could inhibit IL?6 expression in nucleus pulposus cells. The overall trends are the same at the gene and protein level. Thus, this MS2?GFP system is an effective tool for visualizing dynamic IL?6 transcription regulation during disc degeneration therapy such as PEMF treatment. For recapitulating physiological conditions that are more clinically relevant, PEMF treatment will be applied in explant or organ culture model. Most importantly, it also could be a promising tool for treatment screening and optimization for other musculoskeletal disease therapy.

CONCLUSION

Dynamic imaging of mRNA transcription demonstrated the inhibitory effects of PEMF treatments on IL?6 transcription induced by pro?inflammatory factor IL?1?. The results indicated that PEMF treatment could be used as a potential therapy to protect tissue from the high inflammatory cytokine environment during disc degeneration. We also show that the MS2?tagged GFP reporter system is a promising tool for sensitively tracking mRNA transcription in individual cells, which could be used for investigating biological and pathological mechanisms associated with disc degeneration, and for optimizing therapies such as PEMF for the treatment of low back pain and other musculoskeletal diseases. The MS2?GFP reporter system is a promising tool to visualize mechanotransduction with high spatiotemporal resolution in living cells in musculoskeletal research.

AUTHORS’ CONTRIBUTIONS

This study was designed by Jeffery Lotz, Tamara Alliston, Dezba Coughlin and Xinyan Tang. Data were collected and analyzed by Xinyan Tang and Stephanie Miller, data interpreted by all authors; the manuscript was drafted by Xinyan Tang, and revised by Jeffery Lotz, Tamara Alliston, Dezba Coughlin, Nianli Zhang, Erik I Waldorff and James T Ryaby. All authors approve the final submitted version.

 

Supporting information

Additional supporting information may be found in the online version of this article.

Supporting Figure S1.

Supporting Figure S2.

ACKNOWLEDGMENT

This research was supported by Orthofix Inc., Lewisville, Texas.

Notes

Conflict of interest: None

REFERENCES

1. Katz JN. 2006. Lumbar disc disorders and low?back pain: socioeconomic factors and consequencesJ Bone Joint Surg Am 88:21–24. [PubMed[]
2. Hoy D, March L, Brooks P, et al. 2010. The global burden of low back pain: estimates from the Global Burden of Disease studyAnn Rheum Dis 73:968–974. [PubMed[]
3. Martin BI, Deyo RA, Mirza SK, et al. 2008. Expenditures and health status among adults with back and neck problemsJAMA 299:656–664. [PubMed[]
4. Kao TH, Peng YJ, Tsou HK, et al. 2014. Nerve growth factor promotes expression of novel genes in intervertebral disc cells that regulate tissue degradation: laboratory investigationJ Neurosurg Spine21:653–661. [PubMed[]
5. Yurube T, Takada T, Suzuki T, et al. 2012. Rat tail static compression model mimics extracellular matrix metabolic imbalances of matrix metalloproteinases, aggrecanases, and tissue inhibitors of metalloproteinases in intervertebral disc degenerationArthritis Res Ther 14:R51. [PMC free article][PubMed[]
6. Mern DS, Beierfu? A, Fontana J, et al. 2014. Imbalanced potein expression patterns of anabolic, catabolic, anti?catabolic and inflammatory cytokines in degenerative cervical disc cells: new indications for gene therapeutic treatments of cervical disc diseasesPLoS ONE 9:e96870. [PMC free article][PubMed[]
7. Le Maitre CL, Freemont AJ, Hoyland JA. 2005. The role of interleukin?1 in the pathogenesis of human intervertebral disc degenerationArthritis Res Ther 7:R732–R745. [PMC free article] [PubMed[]
8. Sakai D, Andersson GB. 2015. Stem cell therapy for intervertebral disc regeneration: obstacles and solutionsNat Rev Rheumatol 11:243–256. [PubMed[]
9. Illien?Jünger S, Sedaghatpour DD, Laudier DM, et al. 2016. Development of a bovine decellularized extracellular matrix?biomaterial for nucleus pulposus regenerationJ Orthop Res 34:876–888.[PMC free article] [PubMed[]
10. Altun I. 2016. Cytokine profile in degenerated painful intervertebral disc: variability with respect to duration of symptoms and type of diseaseSpine J 16:857–861. [PubMed[]
11. Gabr MA, Jing L, Helbling AR, et al. 2011. Interleukin?17 synergizes with IFN ? or TNF? to promote inflammatory mediator release and intercellular adhesion molecule?1 (ICAM?1) expression in human intervertebral disc cellsJ Orthop Res 29:1–7. [PMC free article] [PubMed[]
12. Kang JD, Stefanovic?Racic M, McIntyre LA, et al. 1997. Toward a biochemical understanding of human intervertebral disc degeneration and herniation ? Contributions of nitric oxide, interleukins, prostaglandin E?2, and matrix metalloproteinasesSpine 22:1065–1073. [PubMed[]
13. Risbud MV, Shapiro IM. 2014. Role of cytokines in intervertebral disc degeneration: pain and disc contentNat Rev Rheumatol 10:44–56. [PMC free article] [PubMed[]
14. Studer RK, Vo N, Sowa G, et al. 2011. Human nucleus pulposus cells react to IL?6: independent actions and amplification of response to IL?1 and TNF?alphaSpine (Phila Pa 1976) 36:593–599. [PubMed[]
15. Phillips KL, Cullen K, Chiverton N, et al. 2015. Potential roles of cytokines and chemokines in human intervertebral disc degeneration: interleukin?1 is a master regulator of catabolic processes.Osteoarthritis Cartilage 23:1165–1177. [PubMed[]
16. Gruber HE, Hoelscher GL, Ingram JA, et al. 2013. Increased IL?17 expression in degenerated human discs and increased production in cultured annulus cells exposed to IL?1ss and TNF?alphaBiotech Histochem 88:302–310. [PubMed[]
17. Tian Y, Yuan W, Fujita N, et al. 2013. Inflammatory cytokines associated with degenerative disc disease control aggrecanase?1 (ADAMTS?4) expression in nucleus pulposus cells through MAPK and NF?kappaBAm J Pathol 182:2310–2321. [PMC free article] [PubMed[]
18. Gu SX, Li X, Hamilton JL, et al. 2015. MicroRNA?146a reduces IL?1 dependent inflammatory responses in the intervertebral discGene 555:80–87. [PMC free article] [PubMed[]
19. Foley KT, Mroz TE, Arnold PM, et al. 2008. Randomized, prospective, and controlled clinical trial of pulsed electromagnetic field stimulation for cervical fusionSpine J8:436–442. [PubMed[]
20. Garland DE, Moses B, Salver W. 1991. Fracture healing: long?term follow?up of fracture nonunions treated with PEMFsContemp Orthop 22:295–302. [PubMed[]
21. Bassett CA, Mitchell SN, Gaston SR. 1982. Pulsing electromagnetic field treatment in ununited fractures and failed arthrodesesJAMA 247:623–628. [PubMed[]
22. Bagnato GL, Miceli G, Marino N, et al. 2016. Pulsed electromagnetic fields in knee osteoarthritis: a double blind, placebo?controlled, randomized clinical trialRheumatology 55:755–762. [PMC free article][PubMed[]
23. Androjna C, Fort B, Zborowski M, et al. 2014. Pulsed electromagnetic field treatment enhances healing callus biomechanical properties in an animal model of osteoporotic fractureBioelectromagnetics35:396–405. [PubMed[]
24. De Mattei M, Pasello M, Pellati A, et al. 2003. Effects of electromagnetic fields on proteoglycan metabolism of bovine articular cartilage explantsConnect Tissue Res 44:154–159. [PubMed[]
25. Chalidis B, Sachinis N, Assiotis A, et al. 2011. Stimulation of bone formation and fracture healing with pulsed electromagnetic fields: biologic responses and clinical implicationsInt J Immunopathol Pharmacol 24:17–20. [PubMed[]
26. Liu M, Lee C, Laron D, et al. 2017. Role of pulsed electromagnetic fields (PEMF) on tenocytes and myoblasts ? potential application for treating rotator cuff tearsJ Orthop Res 35:956 –964. [PubMed[]
27. Sun LY, Hsieh DK, Lin PC, et al. 2010. Pulsed electromagnetic fields accelerate proliferation and osteogenic gene expression in human bone marrow mesenchymal stem cells during osteogenic differentiationBioelectromagnetics 31:209–219. [PubMed[]
28. de Girolamo L, Stanco D, Galliera E, et al. 2013. Low frequency pulsed electromagnetic field affects proliferation, tissue?specific gene expression, and cytokines release of human tendon cellsCell Biochem Biophys 66:697–708. [PubMed[]
29. Okada M, Kim JH, Hutton WC, et al. 2013. Upregulation of intervertebral disc?cell matrix synthesis by pulsed electromagnetic field is mediated by bone morphogenetic proteinsJ Spinal Disord Tech26:167–173. [PubMed[]
30. Gómez?Ochoa I, Gómez?Ochoa P, Gómez?Casal F, et al. 2011. Pulsed electromagnetic fields decrease proinflammatory cytokine secretion (IL?1beta and TNF?alpha) on human fibroblast?like cell culture.Rheumatol Int 31:1283–1239. [PubMed[]
31. Varani K, Padovan M, Vincenzi F, et al. 2011. A2A and A3 adenosine receptor expression in rheumatoid arthritis: upregulation, inverse correlation with disease activity score and suppression of inflammatory cytokine and metalloproteinase releaseArthritis Res Ther 13:R197. [PMC free article][PubMed[]
32. Vincenzi F, Targa M, Corciulo C, et al. 2013. Pulsed electromagnetic fields increased the anti?inflammatory effect of A(2)A and A(3) adenosine receptors in human T/C?28a2 chondrocytes and hFOB 1.19 osteoblastsPLoS ONE 8:p.e65561. [PMC free article] [PubMed[]
33. Selvam R, Ganesan K, Narayana Raju KV, et al. 2007. Low frequency and low intensity pulsed electromagnetic field exerts its antiinflammatory effect through restoration of plasma membrane calcium ATPase activityLife Sci 80:2403–2410. [PubMed[]
34. Reihani Kermani H, Pourghazi M, Mahani SE. 2014. Effects of pulsed electromagnetic field on intervertebral disc cell apoptosis in ratsElectromagn Biol Med 33:246–249. [PubMed[]
35. Miller SL, Bradshaw R, Coughlin DG, et al. 2016. Pulsed electromagnetic field (PEMF) treatment reduces expression of genes associated with disc degeneration in human intervertebral disc cellsSpine J16:770–776. [PubMed[]
36. Bertrand E, Chartrand P, Schaefer M, et al. 1998. Localization of ASH1 mRNA particles in living yeastMol Cell 2:37–45. [PubMed[]
37. Fusco D, Accornero N, Lavoie B, et al. 2003. Single mRNA molecules demonstrate probabilistic movement in living mammalian cellsCurr Biol 13:161–167. [PMC free article] [PubMed[]
38. Zenklusen D, Wells AL, Condeelis JS, et al. 2007. Imaging real?time gene expression in living yeast.CSH Protoc pdb.prot 4870 https://doi.org/10.1101/pdb.prot4870 [PMC free article] [PubMed[]
39. Querido E, Chartrand P. 2008. Using fluorescent proteins to study mRNA trafficking in living cells.Methods Cell Biol 85:273–292. [PubMed[]
40. Häkkinen A, Kandhavelu M, Garasto S, et al. 2014. Estimation of fluorescence?tagged RNA numbers from spot intensitiesBioinformatics 30:1146–1153. [PubMed[]
41. Yunger S, Rosenfeld L, Garini Y, et al. 2010. Single?allele analysis of transcription kinetics in living mammalian cellsNat Methods 7:631–633. [PubMed[]
42. Yunger S, Rosenfeld L, Garini Y, et al. 2013. Quantifying the transcriptional output of single alleles in single living mammalian cellsNat Protoc 8:393–408. [PMC free article] [PubMed[]
43. Halstead JM, Lionnet T, Wilbertz JH, et al. 2015. Translation, An RNA biosensor for imaging the first round of translation from single cells to living animalsScience 347:1367–1371. [PMC free article][PubMed[]
44. Femino AM, Fay FS, Fogarty K, et al. 1998. Visualization of single RNA transcripts in situScience280:585–590. [PubMed[]
45. Livak KJl, Schmittgen TD. 2001. Analysis of relative gene expression data using real?time quantitative PCR and the 2(?Delta Delta C (T)) MethodMethods 25:402–408. [PubMed[]
46. Wilkie GS, Davis I. 2001. Drosophila wingless and pair?rule transcripts localize apically by dynein?mediated transport of RNA particlesCell 105:209–219. [PubMed[]
47. Kloc M, Zearfoss NR, Etkin LD. 2002. Mechanisms of subcellular mRNA localizationCell 108:533–544. [PubMed[]
48. Sanchavanakit N, Saengtong W, Manokawinchoke J, et al. 2015. TNF?? stimulates MMP?3 production via PGE2 signalling through the NF?kB and p38 MAPK pathway in a murine cementoblast cell lineArch Oral Biol 60:1066–1074. [PubMed[]
49. Tisherman R, Coelho P, Phillibert D, et al. 2016. NF??B signaling pathway in controlling intervertebral disk cell response to inflammatory and mechanical stressorsPhys Ther 96:704–711.[PMC free article] [PubMed[]
50. Zhang J, Xu H, Han Z, et al. 2017. Pulsed electromagnetic field inhibits RANKL?dependent osteoclastic differentiation in RAW264.7 cells through the Ca2 + ?calcineurin?NFATc1 signaling pathwayBiochem Biophys Res Commun 482:289–295. [PubMed[]

Formats:

    • Article

|

|

|

|

Recent Activity

See more…

J Orthop. 2017 Jun 29;14(3):410-415. doi: 10.1016/j.jor.2017.06.016. eCollection 2017 Sep.

Electromagnetic transduction therapy in non-specific low back pain: A prospective randomised controlled trial.

Krath A1, Klüter T1, Stukenberg M1, Zielhardt P1, Gollwitzer H2, Harrasser N2, Hausdorf J3, Ringeisen M4, Gerdesmeyer L1,2.

Author information

1
Department of Orthopaedic Surgery and Traumatology, University Schleswig Holstein, Campus Kiel, Germany.
2
Department of Orthopedic and Traumatology, Technical University Munich, Klinikum Rechts der Isar, Germany.
3
Department of Orthopaedic Surgery, Physical Medicine and Rehabilitation, University Hospital of Munich (LMU), Germany.
4
Orthopaedic Medical Center Dr. Ringeisen, Konrad-Adenauer-Allee 33, 86150 Augsburg, Germany.

Abstract

OBJECTIVES:

A prospective randomised controlled trial to investigate the efficacy of electromagnetic transduction therapy (EMTT) for treatment of patients with non-specific low back pain.

DESIGN:

Two groups with non-specific low back pain were either treated with conventional therapy alone over 6 weeks or in combination with 8 sessions of EMTT.

RESULTS:

In both intervention groups the low back pain related pain and the degree of disability decreased significantly at follow-up visits. Combination of EMTT and conventional therapy proved significant superior to conventional therapy alone.

CONCLUSION:

EMTT is a promising treatment in patients with non-specific low back pain.

Future Sci OA. 2016 Feb 11;2(1):FSO105. doi: 10.4155/fsoa-2015-0019. eCollection 2016.

Electromagnetic fields in the treatment of chronic lower back pain in patients with degenerative disc disease.

Arneja AS1, Kotowich A2, Staley D3, Summers R4, Tappia PS5.

Author information

  • 1Rehabilitation Hospital, Internal Medicine, Winnipeg, Manitoba, Canada; Rehabilitation Hospital, Internal Medicine, Winnipeg, Manitoba, Canada.
  • 2BioResonance Technology Inc., Winnipeg, Manitoba, Canada; BioResonance Technology Inc., Winnipeg, Manitoba, Canada.
  • 3St. Boniface Hospital Research, Office of Clinical Research, Winnipeg, Manitoba, Canada; St. Boniface Hospital Research, Office of Clinical Research, Winnipeg, Manitoba, Canada.
  • 4National Research Council, Institute for Biodiagnostics, Winnipeg, Manitoba, Canada; National Research Council, Institute for Biodiagnostics, Winnipeg, Manitoba, Canada.
  • 5St. Boniface Hospital Research, Asper Clinical Research Institute, CR3129-369 Tache Avenue, Winnipeg, Manitoba R2H 2A6, Canada; St. Boniface Hospital Research, Asper Clinical Research Institute, CR3129-369 Tache Avenue, Winnipeg, Manitoba R2H 2A6, Canada.

Abstract

AIM:

To examine the effects of low-amplitude, low frequency electromagnetic field therapy (EMF) therapy in patients with persistent chronic lower back pain associated with degenerative disc disease.

DESIGN:

Double-blind, randomized and placebo controlled.

INTERVENTION:

EMF using a medical device resonator; control group underwent same procedures, except the device was turned off.

OUTCOME MEASURES:

Pain reduction and mobility.

RESULTS:

Improvements in overall physical health, social functioning and reduction in bodily pain were observed in the EMF group. The pain relief rating scale showed a higher level of pain relief at the target area in the EMF group. An increase in left lateral mobility was seen only in the EMF group.

CONCLUSION:

EMF treatment may be of benefit to patients with chronic nonresponsive lower back pain associated with degenerative disc disease.

Int Med Case Rep J. 2014 Dec 31;8:13-22.

An open-label pilot study of pulsed electromagnetic field therapy in the treatment of failed back surgery syndrome pain.

Harper WL1, Schmidt WK2, Kubat NJ3, Isenberg RA4.

Author information

  • 1Tarheel Clinical Research, LLC, Raleigh, NC, USA.
  • 2NorthStar Consulting, LLC, Davis, CA, USA.
  • 3Nicole Kubat Consulting, Pasadena, CA, USA.
  • 4Regenesis Biomedical, Inc., Scottsdale, AZ, USA.

Abstract

Persistent pain following back surgery remains a major treatment challenge. The primary objective of this open-label exploratory study was to investigate the analgesic effectiveness of pulsed electromagnetic field therapy administered twice daily over a 45-day period in 34 subjects (68% female) with persistent or recurrent pain following back surgery. A secondary goal was to guide the design of future randomized controlled trials that could target responsive subpopulations. All predefined primary and secondary outcomes, including change in pain intensity (PI), physical function (Oswestry Disability Index), analgesic consumption, and overall well-being (Patient Global Impression of Change), are reported. A responder analysis (?30% reduction in PI versus baseline) was added as a post hoc evaluation. Safety outcomes, as well as results of a cost-avoidance survey, are also summarized. Of the 30 per-protocol subjects who completed the study, 33% reported a clinically meaningful (?30%) reduction in PI. A higher response rate (60%) was reported for subjects who had undergone discectomy prior to the trial compared to subjects who had undergone other types of surgical interventions (decompression or fusion) without discectomy. Improvements in PI were paralleled by improvements in secondary outcomes. Relative to baseline, responders reported an average 44% and 55% reduction in back PI and leg PI (respectively), and an average 13% improvement in Oswestry Disability Index scores. In the per-protocol population, 50% of responders and 12% of nonresponders reported less analgesia consumption at the end of treatment versus baseline. Sixty-seven percent of per-protocol responders and 0% of nonresponders reported clinically meaningful improvement in overall well-being on the Patient Global Impression of Change scale.

West Indian Med J.  2013 Mar;62(3):205-9.

Evaluation of the efficacy of pulsed electromagnetic therapy in the treatment of back pain: a randomized controlled trial in a tertiary hospital in Nigeria.

Oke KI1, Umebese PF2.
  • 1Department of Physiotherapy, University of Benin Teaching Hospital, Benin City, Edo State, Nigeria. kayodeoke2001@yahoo.com
  • 2Department of Orthopaedics and Traumatology, University of Benin Teaching Hospital, Benin City, Edo State, Nigeria.

Abstract

Musculoskeletal system disorders (MSDs) are amongst the most commonly encountered problems in orthopaedics and physiotherapy practice all over the world and back pain is amongst the most prevalent of musculoskeletal presentations encountered in clinical practice. The attendant deformities, huge economic loss among many other sequelae on the affected individuals have always informed the search for cost-effective treatment modalities that are non-invasive and are devoid of or at least have minimal side effects. This randomized controlled trial was conducted to assess the therapeutic efficacy of the use of a non-pharmacological device [pulsed electromagnetic field (PEMF)] modality in the treatment of back pain. A total of 16 patients (mean age: 42.82 +/- 8.63 years) with back pain without radiculopathy who met the inclusion criteria were purposively enrolled in the study. Patients were randomly assigned into two groups. Group A had eight patients treated with PEMF plus medications (analgesics, nonsteroidal anti-inflammatory – diclofenac sodium) while the eight patients in group B were treated with only standard medications. The PEMF device was applied in group A four times a day for the period the patients were admitted (maximum of nine days). Measured outcome parameters were reduction in pain as assessed with numeric pain rating scale (NPRS) and improvement in functional ability status as assessed with functional activity scale (FAS). Obtained data were analysed with paired and independent t-test to test the significant efficacy of the treatment outcomes in the two groups. There was a statistically significant faster pain relief and resumption of active functions in patients treated with PEMF plus analgesic compared with the rates exhibited by patients treated with standard analgesics alone. These results suggest that PEMF therapy is beneficial in reducing pain and disability in patients with back pain and should be made part of holistic cape for back pain. Further studies using PEMF on larger patient populations are advocated to further confirm the efficacy of PEMF therapy in back pain management.

 

Pain Pract. 2007 Sep;7(3):248-55.

Prospective, randomized, single-blind, sham treatment-controlled study of the safety and efficacy of an electromagnetic field device for the treatment of chronic low back pain: a pilot study.

Harden RN, Remble TA, Houle TT, Long JF, Markov MS, Gallizzi MA.

Center for Pain Studies, Chicago, Illinois 60611, USA. nharden@ric.org

Abstract

OBJECTIVES: To evaluate the efficacy and safety of therapeutic electromagnetic fields (TEMF) on chronic low back pain. Secondary objectives included the investigation of the effects of TEMF on psychometric measures.

SETTING: Pain Research center in an Urban Academic Rehabilitation Facility.

DESIGN: Prospective, randomized, single-blind, placebo (sham) treatment-controlled design in which participants were evaluated over a 6-week period. A total of 40 subjects were randomly assigned: 20 subjects to 15 milliTESLA (mT) treatment using a prototype electromagnetic field device and 20 to sham treatment.

INTERVENTIONS: After a 2-week baseline period, eligible individuals were randomized to one of the treatment groups (sham or 15 mT) for six 30-minute treatments over 2 weeks, then a 2-week follow-up period.

OUTCOME MEASURES: The primary outcome measure was the self-report of pain severity using a 100 mm visual analog scale collected using a twice daily McGill Pain Questionnaire-Short Form. Several secondary measures were assessed.

RESULTS: Both groups (15 mT and sham) improved over time (P < 0.05). Although groups were similar during the treatment period, treated subjects (TEMF of 15 mT) improved significantly over sham treatment during the 2-week follow-up period (20.5% reduction in pain; F(1,34) = 10.62, P = 0.003). There were no reported serious adverse events.

CONCLUSIONS: This study demonstrates that TEMF may be an effective and safe modality for the treatment of chronic low back pain disorders. More studies are needed to test this hypothesis.

Electromagn Biol Med. 2007;26(4):311-3.

Utilization of extremely low frequency (ELF) magnetic fields in chronic disease; five years experience: three case reports.

Mancuso M, Ghezzi V, Di Fede G.

Institute of Biological Medicine, Milano, Italy.

Abstract

We present three examples of the use of ELF magnetic therapy, two cases of multiple sclerosis and one of chronic pulmonary disease. In each of the two MS cases the Seqex device was applied as an adjunct to antioxidant medication two times a week for six weeks. Radiological and MRI examination indicated improvement in the two MS patients and stabilization in the patient with obstructive pulmonary disease following merely five treatments.

Complement Ther Clin Pract. 2007 Feb;13(1):4-14. Epub 2006 Oct 18.

An experimental study comparing the effects of combined transcutaneous acupoint electrical stimulation and electromagnetic millimeter waves for spinal pain in Hong Kong.

Yip YB, Tse HM, Wu KK.

School of Nursing, Faculty of Health and Social Sciences, The Hong Kong Polytechnic University, Hong Kong, PR China. yipvera@gmail.com

Abstract

OBJECTIVES: To compare the efficacy of combined transcutaneous acupoint electrical stimulation (TAES) and electromagnetic millimeter wave (EMMW) therapy as an add-on treatment for pain relief and physical functional activity enhancement among adults with sub-acute non-specific spinal pain in either the low back or neck.

DESIGN: A non-blinded study with data obtained before, immediate, one week and three months after intervention.

SETTING: The Telehealth Clinic and Community Centre, Hong Kong.

PARTICIPANTS: Forty-seven subjects with either sub-acute neck or low back pain.

INTERVENTION: Subjects were randomly allocated to either an intervention group (n=23) or a control group (n=24). These groups were then divided into subgroups according to the site of their spinal pain-neck or back. The intervention group had eight treatments over a three-week period of TAES and EMMW.

OUTCOME MEASURES: Changes from baseline to the end of treatment were assessed at intervals of one week and three months on either neck or low back pain intensity [by Visual Analogue Scale (VAS)]; stiffness level; stress level; neck or low back lateral flexion and forward flexion in cm, and interference with daily activities.

RESULTS: The baseline VAS scores for the intervention and control groups were 5.34 and 5.18 out of 10, respectively (P value=0.77). At the one week and three month assessments, there were no significant differences between the groups-VAS (P value=0.09 and 0.27, respectively). A further subgroup of chronic pain sufferers (n=31) was identified and these had significantly reduced pain intensity at the one week assessment (P value=0.04) but this was not sustained at post three months after treatment (P value=0.15). Improvements in stiffness level, stress level, and functional disability level in the intervention group were not significant.

CONCLUSIONS: Our study shows that there was a reduction in pain intensity, stress and stiffness level immediately after the eight sessions of treatment (TAES and EMMW), though the effect is not sustained after a week. No pain relief was found with the neck pain subgroup. However, the reduction in subjective average pain intensity among the chronic pain subgroup was sustained at the post one week assessment for the intervention group but not at the post three month assessment.

J Int Med Res. 2006 Mar-Apr;34(2):160-7.

Efficacy of pulsed electromagnetic therapy for chronic lower back pain: a randomized, double-blind, placebo-controlled study.

Lee PB, Kim YC, Lim YJ, Lee CJ, Choi SS, Park SH, Lee JG, Lee SC.

Department of Anesthesiology and Pain Medicine, Seoul National University College of Medicine, Seoul, Korea.

Abstract

This randomized, double-blind, placebo-controlled clinical trial studied the effectiveness of pulsed electromagnetic therapy (PEMT) in patients with chronic lower back pain. Active PEMT (n = 17) or placebo treatment (n = 19) was performed three times a week for 3 weeks. Patients were assessed using a numerical rating scale (NRS) and revised Oswestry disability scores for 4 weeks after therapy. PEMT produced significant pain reduction throughout the observation period compared with baseline values. The percentage change in the NRS score from baseline was significantly greater in the PEMT group than the placebo group at all three time-points measured. The mean revised Oswestry disability percentage after 4 weeks was significantly improved from the baseline value in the PEMT group, whereas there were no significant differences in the placebo group. In conclusion, PEMT reduced pain and disability and appears to be a potentially useful therapeutic tool for the conservative management of chronic lower back pain.

Neurorehabilitation. Volume 17, Number 1 / 2002: 63 – 67

Evaluation of electromagnetic fields in the treatment of pain in patients with lumbar radiculopathy or the whiplash syndrome

Ch. Thuile A1 and M. Walzl A2

A1 International Society of Energy Medicine, Vienna, Austria
A2 State Clinic of Neurology and Psychiatry, Graz, Austria

Abstract:

Back pain and the whiplash syndrome are very common diseases involving tremendous costs and extensive medical effort. A quick and effective reduction of symptoms, especially pain, is required. In two prospective randomized studies, patients with either lumbar radiculopathy in the segments L5/S1 or the whiplash syndrome were investigated. Inclusion criteria were as follows: either clinically verified painful lumbar radiculopathy in the segments L5/S1 and a Laségue’s sign of 30 degrees (or more), or typical signs of the whiplash syndrome such as painful restriction of rotation and flexion/extension. Exclusion criteria were prolapsed intervertebral discs, systemic neurological diseases, epilepsy, and pregnancy. A total of 100 patients with lumbar radiculopathy and 92 with the whiplash syndrome were selected and entered in the study following a 1:1 ratio. Both groups (magnetic field treatment and controls) received standard medication consisting of diclofenac and tizanidine, while the magnetic field was only applied in group 1, twice a day, for a period of two weeks. In patients suffering from radiculopathy, the average time until pain relief and painless walking was 8.2 – 0.5 days in the magnetic field group, and 11.7 – 0.5 days in controls p < 0.04). In patients with the whiplash syndrome, pain was measured on a ten-point scale. Pain in the head was on average 4.6 before and 2.1 after treatment in those receiving magnetic field treatment, and 4.2/3.5 in controls. Neck pain was on average 6.3/1.9 as opposed to 5.3/4.6, and pain in the shoulder/arm was 2.4/0.8 as opposed to 2.8/2.2 (p < 0.03 for all regions). Hence, magnetic fields appear to have a considerable and statistically significant potential for reducing pain in cases of lumbar radiculopathy and the whiplash syndrome.

References:

  1. G.B.J. Andersson, The Epidemiology of Spinal Disorder, in: The Adult Spine: Principles and Practice, J.W. Frymoyer, ed., Raven Press, New York, 1991.
  2. V. Grosser, K. Seide and D. Wolter, Berufliche Belastungen und bandscheibenbedingte Erkrankungen der LWS: Derzeit-iger Kausalwissenstand in der Literatur? in: Berufskrankheit 2108: Kausalit¨at und Abgrenzungskriterien, D. Wolter and K. Seide, eds., Springer, Berlin, 1995, pp. 26-38.
Med Pr. 2003;54(6):503-9.

Disorders of locomotor system and effectiveness of physiotherapy in coal miners.

[Article in Polish]

Bilski B, Bednarek A.

Katedry Profilaktyki Zdrowotnej, Akademii Medycznej im. K. Marcinkowskiego w Poznaniu. bilskib@polbox.com

BACKGROUND: The aim of the survey was to analyze the efficacy of physiotherapy applied in coal miners as well as to assess their locomotor system load and the effects of working conditions in mines.

MATERIALS AND METHODS: The questionnaire survey covered a group of 51 miners, aged 28-76 years (mean, 54 years), undergoing physiotherapeutic procedures in the mine out-patient clinic during the first quarter of 2003.

RESULTS: The survey revealed that lumbosacral disorders were the most frequent locomotor system complaints reported by miners, especially those who work in a bending down position. According to the clinical data, spondylosis and allied disorders were the main reasons for pain in this part of the body. Having analyzed the relationship between age and occurrence of back pains, the majority of complaints were found in the 46-55 age group (two complaints per one respondent). The analysis of the association between back pains and duration of employment revealed that the complaints for the locomotor system occurred already after a five-year employment.

CONCLUSIONS: The survey showed that the application of physiotherapeutic procedures diminished the back pain in the study group by 2.83 on average on the 0-10 scale. It was also found that magnetotherapy proved to be the most effective method in treating the spinal degenerative changes.

Adv Ther. 2000 Mar-Apr;17(2):57-67.

Spine fusion for discogenic low back pain: outcomes in patients treated with or without pulsed electromagnetic field stimulation.

Marks RA.

Richardson Orthopaedic Surgery, Texas 75080, USA.

Sixty-one randomly selected patients who underwent lumbar fusion surgeries for discogenic low back pain between 1987 and 1994 were retrospectively studied. All patients had failed to respond to preoperative conservative treatments. Forty-two patients received adjunctive therapy with pulsed electromagnetic field (PEMF) stimulation, and 19 patients received no electrical stimulation of any kind. Average follow-up time was 15.6 months postoperatively. Fusion succeeded in 97.6% of the PEMF group and in 52.6% of the unstimulated group (P < .001). The observed agreement between clinical and radiographic outcome was 75%. The use of PEMF stimulation enhances bony bridging in lumbar spinal fusions. Successful fusion underlies a good clinical outcome in patients with discogenic low back pain.

Bratisl Lek Listy. 1999 Dec;100(12):678-81.

Personal experience in the use of magnetotherapy in diseases of the musculoskeletal system.

[Article in Slovak]

Sadlonova J, Korpas J.

Ist Dpt of Internal Medicine, Jessenius Faculty of Medicine, Comenius University, Martin, Slovakia. bll@fmed.uniba.sk

Therapeutic application of pulsatile electromagnetic field in disorders of motility is recently becoming more frequent. Despite this fact information about the effectiveness of this therapy in the literature are rare. The aim of this study was therefore the treatment of 576 patients who suffered from vertebral syndrome, gonarthritis and coxarthritis. For application of pulsatile electromagnetic field MTU 500H Therapy System was used. Pulsatile electromagnetic field had a frequency valve of 4.5 mT in all studied groups and magnetic induction valve 12.5-18.75 mT in the 1st group. In the 2nd group the intensity was 5.8-7.3 mT and in the 3rd group it was 7.6-11.4 mT. The time of inclination/declination in the 1st group was 20/60 ms, in the 2nd group 40/80 ms and in the 3rd group 40/90 ms. The electromagnetic field was applied during 10 days. In the 1st-3rd day during 20 minutes and in the 4th-10th day during 30 minutes. The therapy was repeated in every patient after 3 months with values of intensity higher by 50%. In the time of pulsatile electro-magnetotherapy the patients were without pharmacotherapy or other physiotherapy. The application of pulsatile electromagnetic field is a very effective therapy of vertebral syndrome, gonarthritis and coxarthritis. The results have shown that the therapy was more effective in patients suffering from gonarthrosis, than in patients with vertebral syndrome and least effective in patients with coxarthosis. Owing to regression of oedema and pain relieve the motility of patients improved. (Tab. 3, Ref. 19.)

Minerva Anestesiol. 1989 Jul-Aug;55(7-8):295-9.

Pulsed magnetic fields.  Observations in 353 patients suffering from chronic pain.

[Article in Italian]

Di Massa A, Misuriello I, Olivieri MC, Rigato M.

Three hundred-fifty-three patients with chronic pain have been treated with pulsed electromagnetic fields. In this work the Authors show the result obtained in the unsteady follow-up (2-60 months). The eventual progressive reduction of benefits is valued by Spearman’s test. We noted the better results in the group of patients with post-herpetic pain (deafferentation) and in patients simultaneously suffering from neck and low back pain.