COVID-19

Logo of canjrespther

Canadian Journal of Respiratory Therapy: CJRT = Revue Canadienne de la Thérapie Respiratoire : RCTR
. 2020; 56: 25–31.
Published online 2020 Jul 23. doi: 10.29390/cjrt-2020-015
PMCID: PMC7428000
PMID: 32844112

Low level laser therapy as a modality to attenuate cytokine storm at multiple levels, enhance recovery, and reduce the use of ventilators in COVID-19

Soheila Mokmeli, MD Anesthesiologistcorresponding author1 and Mariana Vetrici, MD, PhDcorresponding author2
1Canadian Optic and Laser Center (Training Institute), Victoria, BC, Canada
2Department of Biological Sciences, University of Lethbridge, Lethbridge, AB T1K 3M4, Canada
corresponding authorCorresponding author.
Correspondence: Soheila Mokmeli, Canadian Optic and Laser Center (Training Institute), 744A Lindsay Street, Victoria, BC V8Z 3E1, Canada. Tel.: +1 (250) 480-7868, E-mail: moc.oohay@ilemkom.rd Mariana A. Vetrici, Department of Biological Sciences, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada, Tel.: +1 (865) 888-3095, E-mail: moc.liamg@icirtevanairam
This open-access article is distributed under the terms of the Creative Commons Attribution Non-Commercial License (CC BY-NC) (http://creativecommons.org/licenses/by-nc/4.0/), which permits reuse, distribution and reproduction of the article, provided that the original work is properly cited and the reuse is restricted to noncommercial purposes. For commercial reuse, contact moc.trsc@rotide

Abstract

The global pandemic COVID-19 is a contagious disease and its mortality rates ranging from 1% to 5% are likely due to acute respiratory distress syndrome (ARDS), and cytokine storm. A significant proportion of patients who require intubation succumb to the disease, despite the availability of ventilators and the best treatment practices. Researchers worldwide are in search of anti-inflammatory medicines in the hope of finding a cure for COVID-19. Low-level laser therapy (LLLT) has strong, anti-inflammatory effects confirmed by meta-analyses, and it may be therapeutic to ARDS. LLLT has been used for pain management, wound healing, and other health conditions by physicians, physiotherapists, and nurses worldwide for decades. In addition, it has been used in veterinary medicine for respiratory tract disease such as pneumonia. Laser light with low-power intensity is applied to the surface of the skin to produce local and systemic effects. Based on the clinical experience, peer-reviewed studies, and solid laboratory data in experimental animal models, LLLT attenuates cytokine storm at multiple levels and reduces the major inflammatory metabolites. LLLT is a safe, effective, low-cost modality without any side-effects that may be combined with conventional treatment of ARDS. We summarize the effects of LLLT on pulmonary inflammation and we provide a protocol for augmenting medical treatment in COVID-19 patients. LLLT combined with conventional medical therapy has the potential to prevent the progression of COVID-19, minimize the length of time needed on a ventilator, enhance the healing process, and shorten recovery time.

Keywords: COVID-19, ARDS, cytokine storm, low level laser therapy, anti-inflammatory, ventilator, photobiomodulation

INTRODUCTION

What is low level laser therapy?

Low level laser therapy (LLLT) is also known as cold laser therapy or photobiomodulation therapy. LLLT utilizes visible light and infrared laser beams in the range of 450–1000 nm. Single wavelength or monochromatic light is emitted from a low-intensity laser diode (<500 mW). The light source is placed in contact with the skin, allowing the photon energy to penetrate tissue, where it interacts with various intracellular biomolecules to restore normal cell function and enhance the body’s healing processes []. This contrasts with the thermal effects produced by the high-power lasers that are used in cosmetic and surgical procedures to destroy tissue [], as mentioned in the PubMed Medical Subject Heading (MeSH) subheading for LLLT.

LLLT effects are not due to heat but rather to a photochemical reaction that occurs when a photoacceptor molecule within the cell absorbs a photon of light, becomes activated, and changes the cell’s membrane permeability and metabolism. Presently, cytochrome c oxidase, opsins and their associated calcium channels, and water molecules have been identified as the main mediators of the photochemical mechanisms []. This leads to increased mRNA synthesis and cell proliferation. LLLT produces reactive oxygen species (ROS) in normal cells, but ROS levels are lowered when it is used in oxidatively stressed cells, like in animal models of disease. LLLT up-regulates antioxidant defenses and decreases oxidative stress [].

Low-level lasers are a safe, noninvasive technology approved by both the US Food and Drug Administration and Health Canada for several chronic and degenerative conditions, temporary pain relief, cellulite treatment, body contouring, lymphedema reduction, hair growth, and chronic musculoskeletal injuries. LLLT increases microcirculation, lymphatic drainage, and cellular metabolism, thereby relieving many acute and chronic conditions.

The MeSH database in PubMed contains more than 7000 articles on LLLT. The effects of LLLT have been confirmed through several meta–analysis studies and include anti-inflammatory [] and analgesic effects [], tissue healing [], treating tendinopathy [], and improving lymphedema []. Recent lab and animal studies suggest LLLT is ready for clinical trials over myocardial infarction []. In 2010, a meta-analysis concluded that there was strong evidence of an anti-inflammatory effect of LLLT [].

To date, published reports indicate that LLLT up-regulates antioxidant defenses and decreases ROS in oxidatively stressed cells and animal models of disease. The anti-inflammatory effect of LLLT directly addresses the main pathology of disorders such as musculoskeletal, lungs, wounds, brain, trauma, etc. LLLT reduces NF-kB, a protein complex that controls transcription of DNA, in pathological conditions. Reports have shown reductions in reactive nitrogen species and prostaglandins in various animal models [].

LLLT has diverse effects []:

  • reduces pain related to inflammation via dose-dependent reduction of prostaglandin E2, prostaglandin-endoperoxide synthase-2, IL-1, IL-6, TNFa, as well as the cellular influx of neutrophils, oxidative stress, edema, and bleeding;

  • decreases edema and swelling by increasing lymphatic drainage;

  • increases collagen and protein production, and cell proliferation;

  • accelerates wound healing and scar formation;

  • improves quality and tensile strength of tissue;

  • stimulates nerve function and regeneration;

  • accelerates bone regeneration and remineralization;

  • reduces the pain threshold and enhances endorphins;

  • washes inflammatory debris away from the injured site; and

  • augments blood flow.

LLLT has been used in respiratory tract diseases since 1978. Empirical practice on over 1000 patients produced data pertaining to chronic pneumonia, acute pneumonia, asthma, and chronic bronchitis in children, adults, and elderly. Common findings include reduced chest pain and heaviness; normalization of respiratory function; improved blood, immunological, and radiological parameters; and shortened recovery times. In community-acquired pneumonia, intravenous LLLT of blood added to conventional treatment significantly promoted the bactericidal activity of neutrophils. In asthma, the addition of LLLT was more effective than medical treatment alone and it shortened the duration of treatment and recovered bronchial sensitivity to sympathomimetics []. In newborns with pneumonia, LLLT combined with conventional medical regimens optimized the treatment infectious and inflammatory diseases, reduced the incidence of complications, and shortened recovery periods [].

LLLT is a well-known treatment modality in veterinary medicine. Upper and lower respiratory conditions in dogs and cats are common, and viral and bacterial infections are often highly contagious. Regardless of etiology, inflammation is the major pathology of these conditions. The addition of LLLT to conventional treatment alleviates symptoms and stimulates the healing process in tissues. General guidelines for the use of laser therapy in animals and protocols for specific conditions are published [].

The pathogenesis of COVID-19 in respiratory tract

Coronaviruses are a large group of viruses that affect animals. In humans, they produce diseases such as the common cold, severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome. The disease caused by the novel coronavirus, SARS-CoV-2, has been named COVID-19 and the clinical manifestations range from asymptomatic to severe acute respiratory distress syndrome (ARDS) to death [].

Respiratory viruses infect either the upper or lower airways. Typical upper-respiratory infections are milder, more contagious, and spread easily, whereas lower-respiratory infections spread much less frequently but are more severe and dangerous. SARS-CoV-2 appears to infect both upper and lower airways. It spreads while still limited to the upper airways, before traveling into the deeper respiratory tract and leading to severe symptoms [].

SARS-CoV-2 attaches to a protein called angiotensin converting enzyme (ACE2), on the surface of cells in the respiratory tract. As SARS-CoV-2 attacks the cells, dead cells flow down and block the airways with debris while the virus moves deeper into the lungs. Breathing becomes difficult because the lungs become clogged with dead cells and fluid. The immune system attacks the virus causing inflammation and fever. In severe cases, the immune system goes wild, causing more damage to the lungs than the actual virus. Blood vessels dilate to increase blood flow and become more permeable to maximize transport of chemical and cellular mediators the infection site. Inevitably, the lungs get filled with fluid. This exaggerated immune response is called cytokine storm and it leads to ARDS, fever, multiorgan failure, and death [].

During cytokine storm, the immune system attacks indiscriminately without clearing the specific targets. Cytokine storm also affects other organs, especially if people already have chronic diseases []. The severity of cytokine storm determines who is hospitalized and who will be treated in the intensive care unit (ICU). The classification of COVID-19 is summarized in Table 1 [].

Table 1

The staging and classification of COVID-19 []
Class Symptoms Imaging Respiratory criteria
Mild infection Mild Negative signs of pneumonia Normal
Moderate infection Fever and upper respiratory tract symptoms Positive signs of pneumonia Normal
Severe infection Fever, upper and lower respiratory tract symptoms >50% lesion progression within 24–48 hours Respiratory rate ? 30 /min
O2 saturation ? 93% at rest
Arterial partial pressure of O2 (PaO2)/oxygen concentration (FiO2) ? 300 mm Hg
Critical infection Respiratory failure requiring mechanical ventilator and (or) presence of shock and (or) other organ failure that requires monitoring and (or) treatment in the ICU > 50% lesion progression within 24–48 hours Early stage:

  • Oxygenation index 100.1–149.9 mmHg.

  • Respiratory system compliance (RSC) ? 30 ml/cmH2O.

  • No organ failure other than the lungs.

Middle stage:

  • 60 mmHg < O2 index ? l00 mmHg.

  • 30 mL/cmH2O > RSC ? 15 mL/cmH2O.

  • Maybe complicated by mild or moderate dysfunction of other organs.

Late stage:

  • O2 index ? 60 mmHg.

  • RSC < 15 mL/cmH2O.

  • Diffuse consolidation of both lungs that requires the use of extracorporeal membrane oxygenation or failure of other vital organs.

Note: A confirmed case is based on the epidemiological history (including cluster transmission), clinical symptoms (fever and respiratory symptoms), lung imaging, and results of SARS-CoV-2 nucleic acid detection and serum-specific antibodies [].

The morbidity and mortality of COVID-19 are due to excessive inflammatory cytokine production and immune hyperactivity. Alveolar macrophage activation and cytokine storm are the main pathogenesis of severe COVID-19. The pathological features include exudation and hemorrhage, epithelial injuries, infiltration of macrophages into the lungs, and fibrosis of lung tissue. The mucous plug with fibrinous exudate in the alveoli and the activation of alveolar macrophage are characteristic abnormalities []. Chemical and genetic studies have shown that the pulmonary endothelium is a key component of the cytokine storm. Therefore, modulation of the involved cellular signaling pathways may have therapeutic effects [].

COVID-19 begins when SARS-CoV-2 uses ACE2 as the entry receptor for infection []. This induces ACE2 downregulation and shedding. Loss of ACE2 from the endothelium causes dysfunction of the renin-angiotensin system, and it enhances inflammation and vascular permeability. Shedding of ACE2 from the endothelium releases enzymatically active soluble ACE2 (sACE2), which is tightly linked to tumor necrosis factor alpha (TNF-?) production in cell culture [].

Multiple signaling pathways are activated during an immune response and cytokine storm. The P2X purinoceptor 7 (P2X7r) is major factor involved in activation of the cytokine storm and lung pathology in response to viruses [], infection, inflammation, hypoxia, or trauma []. P2X7r is an adenosine triphosphate (ATP) gated, nonselective cation channel, allowing Ca2+ and Na+ influx and K+ efflux. Extracellular ATP plays a central role in apoptotic cell death [], the induction of inflammation [], and mitochondrial failure in monocytes []. P2X7r mediates ATP-induced cell death in different cells and it promotes assembly and release of proinflammatory interleukins (IL-1? and IL-18) from immune cells after exposure to lipopolysaccharide and ATP []. P2X7r is constitutively expressed in many cells, including respiratory epithelial cells and most immune cells like neutrophils, monocytes, macrophages, dendritic, natural killer, B and T lymphocytes [].

Studies stratified COVID-19 patients as: (i) severe symptoms and ICU admission and (ii) mild and moderate symptoms requiring hospitalization but not ICU []. The severe patients have significantly higher levels of plasma pro-inflammatory factors (IL-2, IL-7, IL-10, GSCF, IP-10, MCP-1, MIP1A, TNF-?) [] and (IL-2, IL-6, IL-10, TNF-?) [] than non-ICU patients, and they were likely in cytokine storm []. These findings justify the use of IL-6 receptor antagonists []; however, a therapy to reduce inflammation at multiple levels, such as LLLT, could be more successful in controlling the unbalanced immune response (Figure 1).

An external file that holds a picture, illustration, etc. Object name is cjrt-2020-015-g001.jpg

The effects of SARS-CoV-2 on alveolar cell and cytokine storm.

The effects of LLLT on pulmonary inflammation

LLLT is effective against cytokine storm and ARDS while promoting healing and tissue regeneration. Experimental and animal models of pulmonary disease and infection have revealed multiple cellular and molecular effects, which are both local and systemic. LLLT reduces inflammation without impairing lung function in acute lung injuries and is a promising therapeutic approach for lung inflammatory diseases such as Chronic obstructive pulmonary disease [].

In murine models of acute inflammation of the airways and lungs, transcutaneous LLLT delivered over the trachea decreases pulmonary microvascular leakage [], IL-1b levels [], IL-6 [], MIP-2 mRNA expression [], and intracellular ROS production []. LLLT produces anti-inflammatory effects on tracheal hyperactivity, and reduces neutrophil influx [] by inhibiting COX-2-derived metabolites []. In ARDS, LLLT elevates cyclic adenosine monophosphate [], a signaling molecule that stimulates IL-10 and G-CSF expression and blocks TNF-a and MIP-1. LLLT also reduces TNF-a levels in bronchoalveolar lavage fluid and alveolar macrophages []. In hemorrhagic lesions of the lungs, LLLT significantly reduces the hemorrhagic index and myeloperoxidase activity, to levels comparable to Celecoxib [].

LLLT contributes to the resolution of inflammation by upregulating IL-10 and downregulating P2X7r. LLLT changes the profile of inflammatory cytokines and elevates IL-10 [], known as human cytokine synthesis inhibitory factor, in the lung and abolishes lung inflammation via a reduction of inflammatory cytokines and mast cell degranulation []. LLLT decreases collagen deposition as well as the expression of the P2X7r [].

LLLT contributes to healing by promoting apoptosis of inflammatory cells while suppressing apoptotic pathways in lung tissue. In a model of acute lung injury, LLLT reduced DNA fragmentation and apoptotic pathways via increased B-cell-lymphoma-2 (Bcl-2), the key regulator of the intrinsic or mitochondrial pathway for apoptosis, in alveolar epithelial cells while promoting DNA fragmentation in inflammatory cells []. In pulmonary idiopathic fibrosis, LLLT inhibits pro-inflammatory cytokines and increases expression of proliferating cell nuclear antigen [], attenuates airway remodeling by balancing pro- and anti-inflammatory cytokines in lung tissue, and inhibiting fibroblast secretion of the pro-fibrotic cytokines [].

LLLT provides synergy in combination with medical treatment. It has a synergic anti-inflammatory action over alveolar macrophages pretreated with N-acetyl cysteine, an effective oral medicine for coughs and some lung conditions []. The synergic effects of LLLT combined with conventional treatments were reported on over 1000 patients in Russian studies [].

Extended time on ventilators causes lung injury but LLLT minimizes this side effect. In experimental models of ventilator-induced lung injury (VILI), LLLT following VILI resulted in lower injury scores, decreased total cell count and neutrophil count in bronchoalveolar lavage, and reduced alveolar neutrophil infiltration. LLLT in an experimental model of VILI in rats demonstrated the anti-inflammatory effect via decreased lung injury scores and lower counts of neutrophils in alveolar, interstitial, and bronchial lavage [] (Figure 2).

An external file that holds a picture, illustration, etc. Object name is cjrt-2020-015-g002.jpg

The effects of SARS-CoV-2 versus LLLT on cytokine storm and lung tissue.

Evidence from the literature supports the use of LLLT for the treatment of COVID-19.

  • It has significant anti-inflammatory effects confirmed by meta–analyses. Eleven cell studies, 27 animal studies, and another six animal studies for drug comparisons and LLLT interactions verified that there is strong evidence of an anti-inflammatory effect of LLLT. The scale of the anti-inflammatory effect is not significantly different than non-steroidal anti-inflammatory drugs, but it is slightly less than glucocorticoid steroids [].

  • It has diverse applications and effects confirmed through several meta-analysis studies include analgesia [], tissue healing [], treating tendinopathy [], and improved lymphedema [].

  • LLLT is approved by the US FDA and Health Canada for several chronic and degenerative conditions, temporary pain relief, cellulite treatment, body contouring, lymphedema reduction, and hair growth. It has been used in veterinary medicine for upper and lower respiratory conditions in dogs and cats [].

  • It has been used for human respiratory tract disease. Empirical use on over 1000 patients produced data pertaining to chronic pneumonia, acute pneumonia, asthma, and chronic bronchitis in children, adults, and the elderly []. Light therapy and LLLT has been mentioned as a potential treatment for pandemic coronavirus infections [].

  • The anti-inflammatory effect of LLLT in lung inflammation is confirmed in at least 14 experimental animal studies. LLLT attenuates cytokine storm at multiple levels and reduces the major inflammatory metabolites such as IL-6 and TNF-?. IL-6 antagonists are being investigated for treating COVID-19 but LLLT reduces the production of IL-6, as well as other chemokines and metabolites [].

  • There are US FDA and Health Canada approved laser machines for pain management, lymphedema after breast cancer surgery, and cellulite treatments that can be used and set to treat lung inflammation.

  • LLLT is an affordable modality compared with other treatments and medicines like IL-6 antagonists. LLLT is a safe, effective, low-cost modality without any reported side-effects compared with other approaches. A laser machine costs Can$35,000.00–200,000.00, and each machine can fully treat 20,000 patients for COVID-19. In comparison, an IL-6 antagonist costs US$1000.00 per injection, and each patient would need 3–6 injections for complete COVID-19 treatment. Treating 20,000 patients would cost US$ 60,000,000.00–US$ 120,000,000.00.

Based on this information, LLLT will accelerate recovery from COVID-19 and will get patients off ventilator support and out of the ICU more rapidly. This could significantly decompress our severely overburdened health care systems.

Therapeutic technique and dosage of LLLT

Laser dose is the amount of energy delivered per second per cm2. The effect of laser therapy is related to the amount of laser energy per cm2. The Arndt-Schultz Law is considered the standard to describe the dose dependent effects of LLLT []. The minimum therapeutic dose for a bio-stimulatory effect for red and infrared laser is 0.01 J/cm2 while for ultraviolet, blue, green laser it is 0.001 J/cm2. LLLT has a noticeable biphasic dose response. The effective stimulation dose is 1 J/cm2 on the target tissue. Doses greater than 10 J/cm2 produces inhibitory effects. The inhibitory effects are used in conditions requiring inhibition and suppression [].

Therapeutic protocol: early phase of COVID-19: (Figure 3Table 2)

An external file that holds a picture, illustration, etc. Object name is cjrt-2020-015-g003.jpg

LLLT for COVID-19.

Table 2

Therapeutic protocol: Early phase of COVID-19
Laser system parameters
Wavelengths Infrared laser (780–900 nm), or red laser (630–660 nm)
Average power 50–100 mW
Dose 4–6 J/cm2
Area 10 cm2
Sessions 3–8 once-daily sessions
Laser probe positions
Intranasal:
1 minute/cm2 (100 mW)
2 minutes/cm2 (50 mW)
Noncontact technique
Over right and left tonsils
1 minute/cm2 (100 mW)
2 minutes/cm2 (50 mW)
Transcutaneous (place laser over the skin)
Over the trachea
1 minute/cm2 (100 mW)
2 minutes/cm2 (50 mW)
Transcutaneous
Over the veins in the cubital areas
8 minute/cm2 (100 mW)
15 minutes/cm2 (50 mW)
Transcutaneous blood laser therapy

Laser parameters:

  • Laser type: infrared laser (780–900 nm), or red laser (630–660 nm)

  • Average power: 50–100 mW

  • Dose: 4–6 J/cm2

  • Area: 10 cm2

  • Time: 1–2 minutes/cm2

  • Sessions: 3–8 once-daily sessions

Laser probe positions:

  • Intranasal: 2 minutes, noncontact technique

  • Over right and left tonsils: transcutaneous (place laser over the skin)

  • Over the trachea: transcutaneous

  • Over the veins in the cubital areas: transcutaneous blood laser therapy, 10–15 minutes

Therapeutic protocol: medium–severe phase of COVID-19: (Figure 3Table 3)

Table 3

Therapeutic protocol: medium–severe phase of COVID-19
Laser system parameters
Wavelengths Infrared laser (780–900 nm), or red laser (630–660 nm)
Average power 50–100 mW
Dose 6–10 J/cm2
Area 10 cm2
Sessions 3–10 once-daily sessions
Laser probes positions
Intranasal:
1 minute/cm2 (100 mW)
2 minutes/cm2 (50 mW)
Noncontact technique
Over right and left tonsils
1 minute/cm2 (100 mW)
2 minutes/cm2 (50 mW)
Transcutaneous (place laser over the skin)
Over the trachea
1 minute/cm2 (100 mW)
2 minutes/cm2 (50 mW)
Transcutaneous
Over the veins in the cubital areas
8 minute/cm2 (100 mW)
15 minutes/cm2 (50 mW)
Transcutaneous blood laser therapy
Over the lungs
1:30–2 minute/cm2 (100 mW)
2–3 minutes/cm2 (50 mW)
Bilaterally over apical, middle, and lower lobes, front and back of thorax; transcutaneous over the intercostal spaces
Over the bronchus
1:30–2 minute/cm2 (100 mW)
2–3 minutes/cm2 (50 mW)
Upper mediastinal area: transcutaneous

Laser parameters:

  • Laser type: infrared laser (780–900 nm) or red laser (630–660 nm)

  • Average power: 50–100 mW

  • Dose: 6–10 J/cm2

  • Area: 10 cm2

  • Time: 2–3 minutes/cm2

  • Sessions: 3–10 once-daily sessions

Laser Probe Positions:

  • Over the lungs: bilaterally over apical, middle, and lower lobes and front and back of thorax, transcutaneous over the intercostal spaces

  • Over the trachea: transcutaneous

  • Over the bronchus: upper mediastinal area, transcutaneous

  • Over right and left tonsils: transcutaneous

  • Over the veins in the cubital areas: transcutaneous blood laser therapy; 10–15 minutes

Contraindications and side effects of LLLT []

Although LLLT is safe and noninvasive and there are no reports of mutagenicity, genotoxicity, or carcinogenicity of LLLT after 60 years of its use. However, there are some contraindications:

  • work over the site of tumors and cancer;

  • benign tumors with possibility of converting to malignant tumors;

  • the first 3 months of pregnancy (in the second and third trimesters, avoid work on abdominal and spine area); and

  • light sensitivity conditions.

Precautions []

  • epiphyseal line in children;

  • glands: avoid ovaries, testes;

  • in patients with severe end organ damage: heart, kidney, liver, and lung;

  • epilepsy: the possibility of nerve discharge is increased in LLLT, especially with low-frequency protocols, 5–10 HZ.

Side effects of LLLT

Optical side effects

Because of the high intensity of lasers and the absorption of its wavelengths by different parts of ocular system, there is a possibility of damage to the eyes. It is important to use protective glasses that can absorb the specific wavelength. Protective glasses for each wavelength are different; therefore, choose the protective goggles specified for each wavelength. Both therapists and clients should wear protective goggles [].

Early sense of healing

The analgesic effect of laser manifests earlier than its healing effect, and the patients feel better because of this, but the actual tissue damage has not yet healed. Patients feel relaxed and more energetic because the pain is gone. However, they must allow enough time for recovery [].

Fatigue and tiredness

Fatigue is the most common symptom following LLLT. This is due to hormonal and metabolite changes after laser therapy that increase expression natural pain killers like endorphins and enkephalins. These metabolites induce relaxation and sleepiness [].

Low blood pressure and dizziness

Very rarely, when the treated area is close to large blood vessels, a patient may experience a temporary drop in the blood pressure and orthostasis. This is due to vasodilatation and increased circulation to the limbs. To avoid dizziness, it is recommended that patients drink fluids before LLLT, and then wait for a few minutes before getting up from the supine position [].

CONCLUSION

COVID-19 is potentially lethal because of cytokine storm and ARDS. Although most patients who contract COVID-19 may recover at home, a significant proportion require hospitalization and (or) ICU treatment. Many of the patients that are placed on ventilators succumb to the disease despite the best treatment practices. Often, patients are maintained on ventilators for longer than expected, and this may contribute to ventilator induced lung injury while depleting the patient’s convalescent resources. Modulation of inflammatory factors and a boost to healing are necessary to help patients come off the ventilators. LLLT is a safe and noninvasive modality that has been used for decades in pain management, wound healing, and health conditions including diseases of the respiratory tract. LLLT was combined successfully with standard medical care to optimize response to treatments, reduce inflammation, promote healing, and accelerate recovery times. Scientific evidence shows that LLLT attenuates the inflammatory cytokines and chemokines in cytokine storm at multiple levels. In addition, LLLT promotes apoptosis of inflammatory cells and protects alveolar cells from damage. These findings suggest that LLLT is a feasible modality in the treatment of ARDS. LLLT can be added to the conventional treatment in COVID-19 at different stages of the disease. Because of its anti-inflammatory effect, and ability to shorten recovery times, LLLT can reduce the need of ventilators in the healing process. Clinical trials are necessary to objectively evaluate the effect of LLLT on COVID-19 treatment and recovery.

Contributors

Soheila Mokmeli and Mariana Vetrici contributed to the conception and design of the work.

Competing interests

All authors have completed the ICMJE uniform disclosure form at www.icmje.org/coi_disclosure.pdf and declare: no financial relationships with any organizations that might have an interest in the submitted work in the previous 3 years; no other relationships or activities that could appear to have influenced the submitted work.

Ethical approval

Informed consent was obtained from all participants.

REFERENCES
1. Cotler HB, Chow RT, Hamblin MR, Carroll J. The use of Low Level Laser Therapy (LLLT) for musculoskeletal painMOJ Orthop Rheumatol 2015;2(5):00068. doi: 10.15406/mojor.2015.02.00068. [PMC free article] [PubMed] [CrossRef[]
2. Hamblin MR. Mechanisms and applications of the anti-inflammatory effects of photobiomodulationAIMS Biophys 2017;4(3):337–61. doi: 10.3934/biophy.2017.3.337. [PMC free article] [PubMed] [CrossRef[]
3. Bjordal JM, Lopes-Martins RAB, Iversen VV. The anti-inflammatory mechanism of low level laser therapy and its relevance for clinical use in physiotherapyMedicine 2010. 15: 286–293 Corpus ID: 27687471. doi: 10.1179/1743288X10Y.0000000001. [CrossRef[]
4. Jang H, Lee H. Meta-analysis of pain relief effects by laser irradiation on joint areasPhotomed Laser Surg 2012. August;30(8):405–17. doi: 10.1089/pho.2012.3240. [PMC free article] [PubMed] [CrossRef[]
5. Woodruff LD, Bounkeo JM, Brannon WM, et al. .. The efficacy of laser therapy in wound repair: a meta-analysis of the literaturePhotomed Laser Surg 2004;22(3):241 Available at: https://www.ncbi.nlm.nih.gov/pubmed/15315732 [Accessed 1 April 2020.] [PubMed[]
6. Tumilty S, Munn J, McDonough S, Hurley DA, Basford JR, Baxter GD. Low level laser treatment of tendinopathy: a systematic review with meta-analysisPhotomed Laser Surg 2010;28(1):3–16. Available at: https://search.pedro.org.au/search-results/record-detail/25413 [Accessed 1 April 2020.] [PubMed[]
7. Smoot B, Chiavola-Larson L, Lee J, Manibusan H, Allen DD. Effect of low-level laser therapy on pain and swelling in women with breast cancer-related lymphedema: a systematic review and meta-analysisJ Cancer Survivorship 2014;9(2). doi: 10.1007/s11764-014-0411-1. [PubMed] [CrossRef[]
8. Simunovic Z. (chapter XIV); Gerard Danhof (chapter V); Laser in medicine and dentistry. European Medical Laser Association, CIP, University Library of Rijekam Croatia. ISBN: 953-6059-30-4; 2000 []
9. Amirov NB. Parameters of membrane permeability, microcirculation, external respiration, and trace element levels in the drug-laser treatment of pneumonia [Article in Russian]Ter Arkh 2002;74(3):40–3. [PubMed[]
10. Derbenev VA, Mikhailov VA, Denisov IN. Use of low-level laser therapy (LLLT) in the treatment of some pulmonary diseases: ten-year experienceProc SPIE 2000;4166:323–5. doi: 10.1117/12.389506. [CrossRef[]
11. Ostronosova NS. Outpatient use of laser therapy in bronchial asthmaTerArkh 2006;78(3):414. [PubMed[]
12. Erkinovna TB, Tulkunovna MH. Efficacy of laser therapy in infants with infectious-inflammatory respiratory diseases. ???????: European Science Review; 2006. ISSN: ????????: 2310-5577. Available at: https://cyberleninka.ru/article/n/efficacy-of-laser-therapy-in-infants-with-infectious-inflammatory-respiratory-diseases [Accessed 1 April 2020.] []
13. Arza RA. The chapter of upper and lower respiratory conditions: photobiomodulationLaser therapy in veterinary medicine. 2017. doi: 10.1002/9781119220190.ch14. [CrossRef[]
14. Wu Z, McGoogan JM. Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: summary of a report of 72 314 cases from the Chinese Center for Disease Control and PreventionJAMA 2020. doi: 10.1001/jama.2020.2648. [PubMed] [CrossRef[]
15. Yong E. Why the coronavirus has been so successful? Science. 2020 Available at: https://www.theatlantic.com/science/archive/2020/03/biography-new-coronavirus/608338/ [Accessed 1 April 2020.]
16. Mehta P, McAuley DF, Brown M, et al. .. COVID-19: consider cytokine storm syndromes and immunosuppressionLancet 2020;395(10229): P1033–4. doi: 10.1016/S0140-6736(20)30628-0. [PMC free article] [PubMed] [CrossRef[]
17. Liang T. According to clinical experience; Handbook of COVID-19 prevention and treatment. Zhejiang University School of Medicine, Hangzhou; 2020. []
18. Wang C, Xie J, Zhao L, et al. .. Alveolar macrophage activation and cytokine storm in the pathogenesis of severe COVID-19Preprint from Research Square; 2020. doi: 10.21203/rs.3.rs-19346/v1. [CrossRef[]
19. Huang C, Wang Y, Li X, et al. .. Clinical features of patients infected with 2019 novel coronavirus in WuhanLancet China 2020. doi: 10.1016/S0140-6736(20)30183-5. [CrossRef[]
20. Damjanovic D, Small CL, Jeyanathan M, et al. .. Immunopathology in influenza virus infection: uncoupling the friend from foe2012 Clin Immunol 144:5769. doi: 10.1016/j.clim.2012.05.005. [PubMed] [CrossRef[]
21. Teijaro JR, Walsh KB, Cahalan S, et al. .. Endothelial cells as regulators of cytokine storms during influenza infectionCell 2011;146:980e91 Available at: https://thorax.bmj.com/content/thoraxjnl/early/2011/12/14/thoraxjnl-2011-201437.full.pdf [Accessed 29 March 2020.] [PMC free article] [PubMed[]
22. Zhou P, Yang XL, Wang XG, et al. .. A pneumonia outbreak associated with a new coronavirus of probable bat originNature 2020. doi: 10.1038/s41586-020-2012-7. [PMC free article] [PubMed] [CrossRef[]
23. Fu Y, Cheng Y, Wu Y. Understanding SARS-CoV-2-mediated inflammatory responses: from mechanisms to potential therapeutic toolsVirol Sin 2020. doi: 10.1007/s12250-020-00207-4. [PMC free article] [PubMed] [CrossRef[]
24. Leyva-Grado VH, Ermler ME, Schotsaert M, et al. .. Contribution of the purinergic receptor P2X7 to development of lung immunopathology during influenza virus infectionmBio 2017. doi: 10.1128/mBio.00229-17. [PMC free article] [PubMed] [CrossRef[]
25. Rosli S, Kirby FJ, Lawlor KE, et al. .. Repurposing drugs targeting the P2X7 receptor to limit hyperinflammation and disease during influenza virus infectionBr J Pharmacol 2019. doi: 10.1111/bph.14787. [PMC free article] [PubMed] [CrossRef[]
26. da Cunha Moraes G, Vitoretti LB, de Brito AA, et al. .. Low-level laser therapy reduces lung inflammation in an experimental model of chronic obstructive pulmonary disease involving P2X7 receptorOxid Med Cell Longev 2018. March 4;2018:6798238. doi: 10.1155/2018/6798238. [PMC free article] [PubMed] [CrossRef[]
27. Kawano A, Tsukimoto M, Noguchi T, et al. .. Involvement of P2X4 receptor in P2X7 receptor-dependent cell death of mouse macrophagesBiochem Biophys Res Commun 2012;419(2):374–80. doi: 10.1016/j.bbrc.2012.01.156. [PubMed] [CrossRef[]
28. He Y, Taylor N, Fourgeaud L, Bhattacharya A. The role of microglial P2X7: modulation of cell death and cytokine releaseJ Neuroinflammation 2017. doi: 10.1186/s12974-017-0904-8. [PMC free article] [PubMed] [CrossRef[]
29. Martínez-García JJ, Martínez-Banaclocha H, Angosto-Bazarra D, et al. .. P2X7 receptor induces mitochondrial failure in monocytes and compromises NLRP3 inflammasome activation during sepsisNat Commun 2019;10:2711. doi: 10.1038/s41467-019-10626-x. [PMC free article] [PubMed] [CrossRef[]
30. Aimbire F, Ligeiro de Oliveira AP, Albertini R et al. .. Low level laser therapy (LLLT) decreases pulmonary microvascular leakage, neutrophil influx and IL-1beta levels in airway and lung from rat subjected to LPS-induced inflammationInflammation 2008;31(3):189–97. doi: 10.1007/s10753-008-9064-4. [PubMed] [CrossRef[]
31. Miranda da Silva C, Peres Leal M, Brochetti RA, et al. .. Low level laser therapy reduces the development of lung inflammation induced by formaldehyde exposurePLoS One 2015. November 16;10(11):e0142816. doi: 10.1371/journal.pone.0142816. [PMC free article] [PubMed] [CrossRef[]
32. Oliveira MC Jr, Greiffo FR, Rigonato-Oliveira NC, et al. .. Low level laser therapy reduces acute lung inflammation in a model of pulmonary and extrapulmonary LPS-induced ARDSJ Photochem Photobiol B 2014;134:57–63. doi: 10.1016/j.jphotobiol.2014.03.021. [PubMed] [CrossRef[]
33. Aimbire F, Albertine R, de Magalhães RG, et al. .. Effect of LLLT Ga-Al-As (685 nm) on LPS-induced inflammation of the airway and lung in the ratLasers Med Sci 2005;20(1):11–20. doi: 10.1007/s10103-005-0339-9. [PubMed] [CrossRef[]
34. de Lima FM, Moreira LM, Villaverde AB, Castro-Faria-Neto HC, Aimbire F. Low-level laser therapy (LLLT) acts as cAMP-elevating agent in acute respiratory distress syndromeLasers Med Sci 2011. May 24;26(3):389–400. doi: 10.1007/s10103-010-0874-x. [PubMed] [CrossRef[]
35. Aimbire F, Lopes-Martins RA, Albertini R, et al. .. Effect of low-level laser therapy on hemorrhagic lesions induced by immune complex in rat lungsPhotomed Laser Surg 2007. April;25(2):112–7. doi: 10.1089/pho.2006.1041. [PubMed] [CrossRef[]
36. de Brito AA, da Silveira EC, Rigonato-Oliveira NC, et al. .. Low-level laser therapy attenuates lung inflammation and airway remodeling in a murine model of idiopathic pulmonary fibrosis: relevance to cytokines secretion from lung structural cellsJ Photochem Photobiol B 2020. January;203:111731. doi: 10.1016/j.jphotobiol.2019.111731. [PubMed] [CrossRef[]
37. Sergio LPDS, Thomé AMC, Trajano LADSN, et al. .. Photobiomodulation prevents DNA fragmentation of alveolar epithelial cells and alters the mRNA levels of caspase 3 and Bcl-2 genes in acute lung injuryPhotochem Photobiol Sci 2018. July 11;17(7):975–83. doi: 10.1039/c8pp00109j. [PubMed] [CrossRef[]
38. Rigonato-Oliveira NC, Brito AA, Moraes G, et al. .. Effect of low-level laser therapy in a model of pulmonary idiopathic fibrosisEur Respir J 2015;46:PA945. doi: 10.1183/13993003.congress-2015.PA945; Available at: https://erj.ersjournals.com/content/46/suppl_59/PA945 [Accessed 21 March 2020.] [CrossRef[]
39. Mafra de Lima F, Balbin Villaverde A, Albertini R, Ligeiro de Oliveira AP, Castro Faria Neto HC, Aimbire F. Low-level laser therapy associated to N-acetylcysteine lowers macrophage inflammatory protein-2 (MIP-2) mRNA expression and generation of intracellular reactive oxygen species in alveolar macrophagesPhotomed Laser Surg 2010;28(6):763–71. doi: 10.1089/pho.2009.2638. [PubMed] [CrossRef[]
40. Enwemekaa CS, Bumahab VV, Masson-Meyersc DS. Light as a potential treatment for pandemic coronavirus infections: a perspectiveJ Photochem Photobiol B 2020;111891. doi: 10.1164/ajrccm-conference.2019.199.1_MeetingAbstracts.A6152. [PMC free article] [PubMed] [CrossRef[]
41. Lucinda LMF, Fazza TF, Fonseca LMC, et al. .. Effect of low-level laser therapy on experimental model of ventilator-induced lung injuryAmerican Thoracic Society; International Conference Abstracts; B31. Acute lung injury & ARDS: transitional and mechanistic studies; 2019. May 22. []
42. Tuner J, Hode L. Laser therapyClinical practice and scientific background. BookGra¨ngesberg, Sweden: Prima Books AB; 2002. ISBN: 91-631-1344-9 []

Articles from Canadian Journal of Respiratory Therapy: CJRT = Revue Canadienne de la Thérapie Respiratoire : RCTR are provided here courtesy of Canadian Society of Respiratory Therapy

.

Logo of pheelsevier

Link to Publisher's site
. 2020 Aug 19 : 111999.
doi: 10.1016/j.jphotobiol.2020.111999 [Epub ahead of print]
PMCID: PMC7435279

Light-based technologies for management of COVID-19 pandemic crisis

aDepartment of Clinical Analysis, Faculty of Pharmaceutical Sciences, University of São Paulo, SP, Brazil
bBioLambda, Scientific and Commercial LTD, São Paulo, SP, Brazil
cGAMA Therapeutics LLC, Massachusetts Biomedical Initiatives, Worcester, USA
dDepartment of Biochemistry, Institute of Chemistry, University of São Paulo, São Paulo, SP, Brazil.
eWellman Center for Photomedicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA
fVaccine and Immunotherapy Center, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA
gLaser Research Centre, Faculty of Health Science, University of Johannesburg, Doornfontein, South Africa
hCenter for Lasers and Applications, Nuclear, and Energy Research Institute, National Commission for Nuclear Energy, São Paulo, SP, Brazil
iDepartment of Chemistry Rice University, Houston, TX, USA
jIdISBA – Fundación de Investigación Sanitaria de las Islas Baleares, Palma, Spain
kDepartment of Internal Medicine, School of Veterinary Medicine and Animal Science, University of São Paulo, São Paulo, SP, Brazil
lSchool of Veterinary Medicine, Metropolitan University of Santos, Santos, Brazil.
mMicromoria LLC, Marlborough, USA
nSchool of Pharmacy and Biomolecular Sciences, Liverpool John Moores University, Liverpool, UK
Caetano P. Sabino: moc.adbmaloib@onateacMauricio S. Baptista: rb.psu.qi@atsitpab
?Corresponding author. rb.psu.qi@atsitpab
??Corresponding author at: Department of Clinical Analysis, Faculty of Pharmaceutical Sciences, University of São Paulo, SP, Brazil. moc.adbmaloib@onateac
1All authors contributed equally to the manuscript
Since January 2020 Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID-19. The COVID-19 resource centre is hosted on Elsevier Connect, the company’s public news and information website. Elsevier hereby grants permission to make all its COVID-19-related research that is available on the COVID-19 resource centre – including this research content – immediately available in PubMed Central and other publicly funded repositories, such as the WHO COVID database with rights for unrestricted research re-use and analyses in any form or by any means with acknowledgement of the original source. These permissions are granted for free by Elsevier for as long as the COVID-19 resource centre remains active.

Abstract

The global dissemination of the novel coronavirus disease (COVID-19) has accelerated the need for the implementation of effective antimicrobial strategies to target the causative agent SARS-CoV-2. Light-based technologies have a demonstrable broad range of activity over standard chemotherapeutic antimicrobials and conventional disinfectants, negligible emergence of resistance, and the capability to modulate the host immune response. This perspective article identifies the benefits, challenges, and pitfalls of repurposing light-based strategies to combat the emergence of COVID-19 pandemic.

Keywords: photoinactivation, ultraviolet, photodynamic, photobiomodulation, germicidal, virucidal, photobiology

1. Introduction

The pandemic spread of the novel coronavirus disease (COVID-19), caused by the SARS-CoV-2 virus, is a red-alert global health threat [,]. In December 2019, COVID-19 expanded from Wuhan throughout China and was then exported throughout the world []. So far, more than 10 million people have been diagnosed with COVID-19 infection, and many more are expected to be diagnosed within the coming months [,]. As the epidemic evolves, national and global organizations are facing an urgent need to coordinate and combat this unprecedented large-scale public health crisis [].

The epidemiological features of COVID-19 (i.e., severity, full spectrum of disease, transmissibility) have not been fully dissected []. The consensus is that the risk for severe acute disease symptoms and death is higher among the elderly and the immunocompromised []. In severe cases, infected patients need to be transferred to intensive care units for tracheal intubation []. This phenomenon is particularly worrisome because it can overwhelm healthcare facilities during the epidemic peak [].

The spread and persistence of SARS-CoV-2 in diverse environments, such as healthcare, community, and residential areas, underlines the urgency for developing effective decontamination approaches as the pandemic crisis evolves []. A successful disinfection strategy coupled with additional infection-prevention countermeasures may substantially reduce transmissibility from asymptomatic carriers, a feature that is considered pivotal in the rapid dissemination of SARS-CoV-2. New light-mediated disinfection protocols are currently validated in hospitals and healthcare facilities for surface, air, and water as well as personal protective equipment (PPE), including eyewear, N95 respirators, and masks. Additionally, photobiomodulation, a light-based anti-inflammatory therapy, may have some palliative effects on patients suffering from severe COVID-19. This review examines the potential of light-based technologies to prevent COVID-19 infection and control its dissemination by direct viral inactivation and to treat COVID-19 by modulating the host immune system. The direct antimicrobial actions of solar and UV radiation, photodynamic therapy, antimicrobial blue light, and ultrafast pulsed lasers for disinfection or in vivo use are considered, and the application of photobiomodulation to stimulate the host to mount an anti-viral response is discussed.

2. SARS-CoV-2 Stability Outside The Human Body

SARS-CoV-2 is highly infectious [] and transmission occurs through contaminated air, water, and surfaces, which plays a pivotal role in its unbridled dissemination. A recent study by van Doremalen and colleagues investigated the stability of SARS-CoV-2 in aerosols and on inanimate surfaces (e.g., glass, metal, plastic, or cardboard) that can act as important transmission vectors []. Their findings suggest that aerosol and fomite transmission of SARS-CoV-2 is likely, indicating that the virus can remain viable and infectious for hours in aerosols and up to days on surfaces. This is in agreement with a recent comparative analysis of 22 studies looking at the persistence of a broader panel of human coronaviruses on inanimate surfaces [] This study included prominent pathogenic coronavirus species such as Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS) and endemic human coronaviruses (HCoV) and concluded that: 1) viruses can remain infectious from 2 h to 9 days; 2) incubation temperature is critical, as some viruses can remain viable at 4 °C for up to 28 days whereas at 30–40 °C viral viability is reduced.

3. Historical Milestones of Antimicrobial Light

The microbicidal effects of light have been widely known for more than a century. In 1885, Duclaux experimented with several microbial species and concluded that “sunlight is the best, cheapest, and most universally applicable microbicidal agent that we have” []. As early as 1877, Downes and Blunt observed that light could effectively kill a series of microorganisms and reported that this effect was dependent on light parameters such as intensity, duration (i.e., light dose) and that the shortest wavelengths (e.g., blue to ultraviolet light) were the most effective [] The first report on the virucidal effects of UV radiation dates back to 1928 when Rivers and Gates used UV light to inactivate viral particles in suspension and proved the efficacy of the method through subsequent subcutaneous inoculation of rabbits [].

In 1903, Niels Finsen was awarded the Nobel Prize in Physiology or Medicine for his contribution to the treatment of infectious diseases, especially cutaneous tuberculosis, using visible light [,]. Virtually at the same time, Herman Von Tappeiner and Oscar Raab discovered by accident that the use of fluorescent dyes could enhance the microbial killing effect of visible light via photodynamic reactions []. By the 1930s, germicidal low-pressure Mercury (Hg) discharge lamps emitting quasi-monochromatic UV-C light (peak emission at 254 nm) had been introduced into the market as highly efficient disinfection equipment []. Thus, since the pre-antibiotic era, light-based strategies have been extensively studied and used to treat and prevent infections []. However, each photoinactivation strategy has its pros and cons that must be carefully considered when designing a new microbial control strategy.

4. Natural Ultraviolet Light

Ultraviolet (UV) radiation is naturally and ubiquitously emitted by the sun, representing 10% of its total light output. Only a small portion of the sunlight spectra has direct antimicrobial properties (UV-C). However, since most UV-C light is filtered by the atmospheric ozone layer, in practical terms, the antimicrobial activity associated with sunlight is mostly caused by photochemical reactions induced by UV-A and UV-B photons which are absorbed by endogenous chromophores such as amino acid residues, flavins, and porphyrin derivatives []. While UV-A alone does not seem to exert any significant virucidal effects, natural and artificial sunlight, as well as radiation in the UV-B spectrum, have been shown to inactivate bacteriophages and human viruses []. A model for the potential of solar UV radiation to inactivate viruses aerosolized in the atmosphere concluded that a full day of sun exposure would on average decrease the infectivity of UV-sensitive viruses by 3 log10 [].

Besides its virucidal potential, solar UV radiation can also play a protective role against infectious diseases via its modulating effect on vitamin D production []. Vitamin D is known to upregulate the production of human cathelicidin, LL-37. This antimicrobial peptide has both antimicrobial and antiendotoxin activities, and also attenuates the production of proinflammatory cytokines which typically accompany respiratory tract infections. Accordingly, it was recently suggested that vitamin D could reduce the incidence, severity, and risk of death due to respiratory tract infections, notably those caused by COVID-19 []. However, conclusive evidence for an association between vitamin D supplementation and decreased risk of respiratory tract infections is still lacking.

UV-C is directly absorbed by pyrimidine bases causing their dimerization, which leads to viral inactivation via DNA or RNA damage []. Thymine is the main chromophore in DNA while uracil is its counterpart in RNA. Upon UV-C exposure, thymine and uracil form cyclobutane-dimers and pyrimidine-protein cross-links []. It must be stressed that UV-C usage must be limited to inanimate objects since it is highly dangerous to human skin. The viral protein coat has been shown to protect nucleic acids from UV-C radiation, by shielding the RNA, quenching the excited states of RNA, and/or by surrounding the bases with a hydrophobic environment and limiting the mobility of the individual bases. This results in a reduction of the overall rate of photoreactions, which allows the formation of non-cyclobutane-type dipyrimidines and uridine hydrates. Viral coating proteins themselves may suffer UV photodamage and become cross-linked to RNA.

The International Ultraviolet Association (IUVA) recently released a fact sheet detailing the efficacy of UV on SARS-CoV-2 [] in which they reviewed all the appropriate requirements for the safety of UV-C disinfection devices and discussed the corresponding performance standards and validation protocols. Coronaviruses display a wide range of UV-C LD90 (UV-C dose necessary to inactivate 90% of a microbial population) values, from 7 to 241 J/m2 so one might assume that the UV-C susceptibility of the novel SARS-CoV-2 (COVID-19) virus probably lies within this range []. Therefore, based on previous studies with SARS-CoV-1 and other RNA-based coronaviruses, UV-C light can be used to effectively inactivate such pathogens present in the air, liquids and over several surfaces [,].

5. Ultraviolet Germicidal Irradiation (UVGI)

UV-C lamps have long been used in hospital and industrial settings for decontamination purposes. In the context of a mitigation approach to infection spreading, UV-C can be particularly helpful in the inactivation of virus-containing aerosols and surfaces.

Air disinfection via upper-room germicidal UV-C light fixtures may be able to reduce viral transmission via the airborne route. Accordingly, an observational study during the 1957 influenza pandemic reported that patients housed in hospital wards with upper-room UV-C had an infection rate of 1.9%, compared to an infection rate of 18.9% among patients housed in wards without UV-C []. However, it is important to note that the germicidal effect of UV-C seems to be strongly dependent on the relative humidity of the air, with UV-C effectiveness against influenza virus decreasing with increasing relative humidity [].

The potential of viral spreading via contaminated surfaces depends on the ability of the virus to maintain infectivity in the environment, which in turn is influenced by several biological, physical, and chemical factors, including the type of virus, temperature, relative humidity, and type of surface []. Importantly, single-stranded nucleic acid (ssRNA and ssDNA) viruses were more susceptible to UV inactivation than viruses with double-stranded nucleic acid (dsRNA and dsDNA). Also, the UV dose necessary to achieve the same level of virus inactivation at 85% relative humidity (RH) was higher than that at 55% RH [].

In a recent study, Fischer et al. showed that UV-C light can inactivate more than 99.9% of SARS-CoV-2 viral particles deposited over the filtering material of N95 masks and stainless steel surface []. As expected, inactivation kinetics over stainless steel was much faster (i.e., more than 99.9% for (0.33 J/cm2). However, after sufficient exposure (1.98 J/cm2) UV-C could promote germicidal efficacy levels that were similar to those promoted by ethanol, dry heat or vaporized hydrogen peroxide. Older studies have hypothesized that the necessary dose to inactivate 90% of viruses present in N95 filtering facepiece respirator (FFR) material would be about 30 times higher than over the surface of non-porous materials []. This was an interesting estimation, but we should keep in mind that UV-C emission spectrum and irradiance of different UV-C equipment as well as material composition are widely variable []. Therefore, such estimatives cannot be used as a robust procedure and experimental demonstrations must always be presented. Indeed, a recent in silico study demonstrated that for effective and fast decontamination one should consider the FFR shape besides the optical properties of the FFR model, which has to be determined at the UV-C specific wavelength []. Even though UV does not seem to affect the filtrating capacity of FFRs, it is important to note that high UV-C doses can lead to reduced tensile strength of its materials [,].

The combination of multiple light wavelengths has been explored for cosmetic, environmental (water disinfection) and clinical (microbial catheter disinfection) applications. However, the precise photobiological mechanism of action and the experimental workflow to develop a marketable application is still missing [,].

It must be remarked that UV-C light at 254 nm is harmful to the eyes and skin and, therefore, it is recommended to use it in setups that avoid direct human exposure. Although, far-UV-C (207–222 nm) has been proposed as a disinfection technology that seems to be safer to human exposure []. This has been claimed because far-UV-C range is strongly absorbed by amino acid residues and, therefore, is further blocked by the acellular stratum corneum of the skin and the cornea of the eye, leading to lower levels of UV-C light reaching the cellular layers of eyes and skin. However, as far as our knowledge goes, robust studies showing the actual safety of far-UV-C towards animal tissues in short and long terms have not been strongly established and degradation of proteins can also lead to serious eye and skin damages. Thus, we can only recommend UV-C application to inanimate objects. Additionally, far-UV-C technology is not broadly available in the market yet and the cost is far higher than common LP-Hg lamps. On the other hand, UV-C LED technology is limited to very compact applications. The shortest wavelengths available are around 255 nm, with the price per Watt being up to 1000 times higher than that of LP-Hg lamps, while displaying an energy efficiency (< 1%) far lower than that of LP-Hg lamps (25–40%) at 254 nm.

6. Photoantimicrobials and Photodynamic Therapy

Visible light can exert antiviral effects via photodynamic mechanisms that are initiated upon absorption of light by exogenous photosensitizer compounds, such as phenothiazinium salts, porphyrins, nanoparticles, and others []. The inactivation of microorganisms and viruses by visible light is based on the generation of lethal oxidant species via photosensitized oxidation reactions, which usually require three components: the chromophore, termed the photosensitizer (PS), light, and oxygen, even though some PS may also work through alternative reactions in the absence of oxygen []. After light absorption, excited oxygen states are quickly formed, initially in the singlet, and subsequently in the triplet states (i.e., considering the photocycle of organic molecules). These species can release the excitation energy in the form of light emission (e.g., fluorescence and phosphorescence) or heat release (non-radiative decay). Since excited states are intrinsically more reactive than ground states, energy and electron transfer reactions can occur. There are two main mechanisms of photosensitized oxidation: Type I reactions depend on the encounter of the excited species with biological substrates. These reactions usually occur through electron or hydrogen abstraction, leading to radical chain reactions; Type II reactions rely on energy transfer reaction from the PS triplet state to molecular oxygen, generating singlet oxygen (1O2) (Fig. 1 ) []. Spacially, type I reactions require the PS to be within a subnanometer distance to the virus, whereas type II reactions allow singlet oxygen diffusion to more than 100 nm [].

Fig. 1

Mechanisms of photosensitized oxidation reactions. The photosensitizer (PS) is a molecule capable of absorbing light depending on its specific absorption spectra. Once excited, the PS is converted from the ground state 1PS to its singlet excited 1PS? and triplet excited 3PS? states. Via Type I (contact-dependent) reactions both 1PS? and 3PS? can react directly with O2 or biomolecules, like carbohydrates, lipids, proteins, or nucleic acids, resulting in the formation of radicals capable of initiating redox chain reactions. Otherwise, 3PS? can react with molecular oxygen (3O2), via the Type II (energy transfer) reaction, generating the reactive state of singlet oxygen (1O2).

Light energy is thus converted into oxidation potential that can damage biomolecules. Antimicrobial photodynamic therapy (aPDT) is based on this process and it has been used to treat localized microbial infections caused by viruses, bacteria, fungi, and parasites []. Among the many pathogens that can be targeted by aPDT, viruses are perhaps the most vulnerable, as they depend on entering a host cell for survival and replication and can be inactivated by damaging the capsid or envelope molecules (lipids, carbohydrates, proteins) or internal molecules (nucleic acids) (Fig. 1). Thus, many viruses can be treated via aPDT, including papillomavirus (HPV), hepatitis A virus (HAV), and herpes simplex virus (HSV) []. Additionally, the disinfection of biological fluids (plasma and blood products) by photoantimicrobials has been performed for decades and is a well-regarded technological application of these compounds. For instance, extracorporeal photoinactivation of coronaviruses and other clinically relevant pathogens using methylene blue (MB)-mediated aPDT has been reported [].

It is possible that photosensitized oxidation can neutralize SARS-CoV-2 and, consequently, play a role in mitigating the ongoing pandemic; however, there is no data available on the photodynamic inactivation of this virus. Thus, here we sought to find and discuss scientific literature that could help predict whether COVID-19 is more or less susceptible to oxidant species generated during aPDT.

While all types of viruses can be neutralized by aPDT, the inactivation efficiency depends on both the PS and the virus [,]. As a rule of the thumb, RNA-type phages are more easily photoinactivated than their DNA-type counterparts, suggesting that SARS-CoV-2, which is an enveloped RNA-type virus, can be easily neutralized by aPDT [,]. Guanine bases are the major targets for oxidation by photosensitizing agents in both RNA and DNA []. The formation of RNA-protein crosslinks may also be an important lesion involved in virus inactivation via aPDT [].

Enveloped viruses are more prone to aPDT neutralization than those without an envelope, due to the role of PS in damaging envelope components [,]. Initial studies on viral inactivation by aPDT demonstrated the importance of the PS reaching specific reaction sites, so-called “marked targets”, for efficient viral inactivation []. Other reports have confirmed the importance of PS binding on the efficiency of virus inactivation via aPDT, and the PS membrane partition coefficients can be used as a predictor of its virus inactivation efficacy [,]. Transmission electron microscopy data has revealed that low PS concentrations degrade envelope surface glycoproteins blocking virus internalization, while higher PS concentrations can destroy lipid membranes []. These results can be interpreted in terms of the current mechanistic understanding of photosensitized oxidation, specifically the important role of direct-contact reactions. Irreversible membrane damage occurs with the abstraction of a hydrogen atom from an unsaturated fatty acid by direct reaction with the triplet excited state of the PS. Subsequent formation of peroxyl and alkoxyl radicals leads to the build-up of truncated lipid aldehydes, which are ultimately responsible for opening membrane pores []. The fact that irreversible damage occurs due to contact-dependent reactions, indicates that the damage can be confined within the nanometer location site of the PS [].

In terms of the application of aPDT to treat COVID-19 patients, it is encouraging to note that this technique is already used to treat several respiratory diseases []. PDT has been used for decades to treat lung cancers and its successful application in the treatment of laryngeal papillomas has also been reported []. Geralde et al. recently demonstrated that acute pneumonia caused by Streptococcus pneumoniae could be treated via inhalation of indocyanine green combined with extracorporeal administration of infrared light []. A prophylactic approach proposed by Soares et al. showed that aPDT can also be used to eliminate bacterial biofilms frequently associated with endotracheal tubes and that can lead to more severe stages of acute respiratory syndromes []. More recently, Schikora and colleagues reported succesfull use of aPDT to disinfect oral and nasal cavity of patients in early stages of COVID-19 infection This approach can potentially lead to a temporary and moderate reduction of disease progression but cannot be regarded as a potential therapeutic procedure since aPDT is limited to local effects and COVID-19 is a systemic disease [].

Considering that: 1) SARS-CoV2 is an enveloped RNA virus, 2) aPDT is efficient at neutralizing such viruses, and 3) light is already used to treat lung and airway-related infections, we propose that aPDT is a good candidate for treating COVID-19 or as an adjunct to disinfect biological fluids. Alternatively, photosensitizers could also be used to decontaminate liquids and surfaces or be incorporated into polymeric matrices such as plastics, fabrics, paper, and paints to produce photoantimicrobial materials [,,]. Allotropes of carbon such as fullerenes, carbon nanotubes, and graphene can also show light-activated antimicrobial effects, including the inactivation of viruses [,,].

7. Antimicrobial Blue Light

Visible blue light exhibits microbicidal effects in the wavelength range of 405–470 nm [,]. High-intensity narrow-spectrum light at 405 nm has been used for continuous decontamination of inpatient and outpatient burn units and patient-occupied intensive care isolation rooms, as well as the treatment of surgical site infections in an orthopedic operating room []. Compared to UV-C, in general terms antimicrobial blue light (aBL) requires a much higher radiant exposure (or longer exposure times) to reach similar levels of microbial inactivation if irradiance of the light sources is similar. Even though aBL displays decreased deleterious effects on mammalian cells, one should avoid direct eye exposure because eye lens focuses visible light and overexposure can promote either flash blindness or retinal lesions.

The exact mechanisms underlying the antimicrobial effects of blue light are not yet completely understood but appear to involve the formation of short-lived reactive oxygen species (ROS) []. The most widely accepted view of the process posits that the photochemical mechanisms of aBL are based on light energy excitation of endogenous microbial intracellular light receptors (chromophores), such as porphyrins and flavins. Once excited, these receptors undergo energy transfer processes that lead to the generation of cytotoxic ROS which react with intracellular components resulting in photodamage and cell death by oxidative stress []. Since endogenous photoreceptors appear to be absent in viruses, the mechanisms by which aBL affects these pathogens remains unclear. However, it is currently known that: 1) the use of exogenous photosensitizers improves the efficiency of inactivation by blue light, and 2) the inactivation is more pronounced when viral particles are present in body fluids, e.g., saliva, feces, and blood plasma, which contain photosensitive substances [,].

Accordingly, antimicrobial blue light has been explored in the treatment of infectious diseases and as a disinfection adjuvant in healthcare settings. Clinical trials have revealed the efficiency of aBL in the treatment of acne, Helicobacter pylori gastrointestinal infections, and dental infections [,]. aBL was recently shown to rescue mice from methicillin-resistant Staphylococcus aureus (MRSA) and Pseudomonas aeruginosa wound infections [,]. Oral anaerobic periodontopathogenic bacteria (Porphyromonas gingivalisPrevotella intermedia, and P. nigrescens) were also inhibited or completely eradicated under blue light irradiation [,].

In a recent bioinformatics study, SARS-CoV-2 infection was reported to be dependent on porphyrin, which it captures from human hemoglobin, resulting in altered heme metabolism []. However, the in silico methods used to obtain such results have been questioned by a commentary publication, putting into doubt wheter SARS-CoV-2 actually interacts with heme metabolism and accumulates porphyrins []. If this thesis is experimentally proven to be correct, aBL might be able to kill SARS-CoV-2 by photoexcitation of its acquired porphyrins. Thus, experimental studies are required to verify the potential of aBL to prevent and control COVID-19.

8. Photobiomodulation Therapy

Photobiomodulation (PBM) employs low levels of red or near-infrared (NIR) light to treat and heal wounds and injuries, reduce pain and inflammation, regenerate damaged tissue, and protect tissue at risk of dying []. Instead of directly targeting viruses, PBM mainly acts on the host cells, which absorb light in the red and near-infrared spectral region []. Literature indicates that photons are absorbed by multiple cellular chromophores, including mitochondrial enzymes, to trigger the biological effects of PBM []. Cytochrome c oxidase (i.e., unit IV in the mitochondrial respiratory chain) appears to play a main role in this process []. Other molecular chromophores include light and heat-sensitive ion channels (transient receptor potential) that, upon light activation, lead to changes in calcium concentrations. Nanostructured water (interfacial water) is also likely to act as a chromophore. Upon irradiation, the mitochondrial membrane potential is raised and oxygen consumption and ATP generation are increased. Subsequent activation of signaling pathways and transcription factors leads to fairly long-lasting effects even after relatively brief exposure of the tissue to light [].

In the early 1900s, Finsen reported that patients exposed to red light exhibited significantly better recovery from smallpox infections than unexposed counterparts []. Since then, PBM has been used in the treatment of acute lung injury, pulmonary inflammation, and models of acute respiratory distress syndrome (ARDS), due to its ability to substantially reduce systemic inflammation while preserving lung function. []. There are currently 90 published papers on PBM concerning “acute lung injury” [] OR “pulmonary inflammation” [] OR “lung inflammation” [] OR “ARDS” [] OR “lung oxidative stress” [] OR “asthma” [] many involving small animal models where it can be argued that light penetrates more easily than in humans. Because COVID-19 involves a “cytokine storm”, PBM delivered to the torso (chest and back) might not only allow some light to reach the lungs but might also reduce the systemic inflammation responsible for COVID-19 sepsis-like syndrome [] and disseminated intravascular coagulation [] that can be deadly []. Moreover, PBM is more effective on hypoxic cells [], suggesting it could be effective for COVID-19 infection, which seems to be characterized by severe hypoxia []. Nevertheless, so far there are no experimental data supporting the influence of PBM on COVID-19. Therefore, clinical studies have to be performed to understand whether PBM therapy may actually reduce the cytokine storm impacts for COVID-19 patients.

Hospitalized patients receiving mechanical ventilation or under high-oxygen continuous positive airway pressure (CPAP) treatment could be placed on an LED pad. These do not generate unacceptable levels of heat, so the high fever experienced by these patients should not be a problem. LED-based PBM devices similar to these have been approved by the FDA for general health and wellness applications, and there are no reported adverse effects []. However, PBM is not recommended to be used over cancerous lesions since the effects on tumor cells are not fully understood yet [].

9. Ultrafast Laser Irradiation

Ultrashort pulse lasers (USPLs) emitting visible to near-infrared light have been used to inactivate a broad spectrum of viruses (human immunodeficiency virus, human papillomavirus, encephalomyocarditis virus, M13 bacteriophage, tobacco mosaic virus, and murine cytomegalovirus) with no damage to human or murine cells []. Regardless of wavelength, ultrafast laser irradiation at low mean irradiance levels (? 1 W/cm2) does not promote ionization effects that could impair host cells. This irradiation does not appear to destroy either bovine serum albumin or single-stranded DNA, nor cause adverse effects like those produced by toxic or carcinogenic chemicals. Previous works suggest that the antimicrobial effect of USPLs at low mean irradiance is exerted via impulsive stimulated Raman scattering, whereby high-frequency resonance vibrations provoke vibrations of sufficient strength to disintegrate the capsid into subunits through the breaking of weak links (e.g., hydrogen bonds and hydrophobic contacts) in non-enveloped viruses []. For enveloped virus, USPLs promote vibrations on the proteins of the capsid. These excitations break the hydrogen bonds and hydrophobic contacts causing partial unfolding of the proteins. Since the concentration of confined proteins is very high within the capsid of a virus, they can assemble with other neighboring proteins, leading to the aggregation of proteins []. In contrast, an intense laser pulse could generate shock wave-like vibrations upon impact with the virus to promote viral inactivation [].

However, laser pulsing may not be necessary for its antimicrobial action. Recently, Kingsley et al. applied a tunable mode-locked Ti-Sapphire laser emitting femtosecond pulses at wavelengths of 400, 408, 425, 450, 465, and 510 nm to verify inactivation of murine norovirus (MNV) []. Using an average power of 150 mW, authors observed that femtosecond-pulsed light emitting at 408, 425 and 450 nm promoted more than 99.9% of virus inactivation after 3 h of illumination, indicating that the inactivation mechanism is not wavelength-specific. In addition, they reported that a continuous wave 408 nm laser at similar power also promoted reduction of plaque-forming units, although the addition of exogenous photosensitizers has increased MNV inactivation. These data suggest that virus inactivation does not require pulsing and can be improved in the presence of singlet oxygen enhancers, as previously reported for aBL (see section 7).

Potential use of USPLs encompasses the inactivation of pathogens in pharmaceuticals, blood products and uncooked foods as well as chemical-free whole inactivated virus vaccine preparation [,]. Laser treatment resulted in 1-log, 2-log, and 3-log reductions in hepatitis A, human immunodeficiency, and murine cytomegalovirus, respectively, in human plasma with no changes in the structure of fibrinogen []. Further, in mice USPL-induced inactivation of H1N1 influenza virus was more effective than formalin and did not cause damage to viral surface proteins or resulted in the production of carbonyl groups in proteins [].

Concluding remarks

As we presented in this review, light-based technologies have unique features that could be useful to face the COVID-19 pandemic, but could also present pitfalls that deserve to be highlighted. Thus, we compiled at Table 1 their advantages and disadvantages.

Table 1

Light-based strategies available to combat the emergence of COVID-19 pandemic. FFR: filtering facepiece respirator.

Light-based Platform Potential Applications Advantages Disavantages
Natural Ultraviolet Light Synthesis of vitamin D Sunburn following overexposure
Microbicidal activity Long-term aging and cancer risk
Ultraviolet Germicidal Irradiation Surface, FFR reuse, air and water disinfection Low exposure time to reach high levels of pathogen inactivation (< 1 min) depending on irradiance of light source Risk of tissue damage and cancer
Potential long-term degradation of materials
Photoantimicrobials and Photodynamic Therapy Environmental and surface disinfection, therapeutics, virus inactivation in biological products Efficient and selective pathogen inactivation following short period of illumination if photosensitizer is resonant to light source wavelength Photosensitizer could promote material and/or tissue staining
Systemic PS administration may cause photosensitivity
Succesfull results depend on light parameters, type of microorganism, PS concentration and pre-irradiation time
Non-invasive approach
Succesfull results in humans with artificial light sources
Antimicrobial Blue Light Environmental and surface disinfection, therapeutics, virus inactivation in biological materials Can be used in inhabited places and to treat infections in humans Long exposure time (above 30 min)
No notable detrimental effect in materials following long periods of illumination
Effect is more pronounced in the presence of exogenous photoabsorbers
Photobiomodulation Therapy Therapeutics Non-invasive technique Succesfull results depend on light parameters, patient characteristics and disease aetiology
Succesfull results in humans with artificial light sources
Adjuvant to conventional therapies
Ultrafast Laser Irradiation at low irradiance Selective virus inactivation in blood products, pharmaceuticals, food and vaccine development Selective pathogen inactivation Long exposure time (~3 h)
Chemical-free vaccine preparation Expensive light sources

In summary, we have described how light-based strategies can be used to reduce SARS-CoV-2 transmission through air, water, and surfaces as well as potential therapeutic applications that can reduce COVID-19 morbidity and mortality. From our perspective, light provides several practical answers to the new logistical and therapeutic challenges brought by COVID-19. Therefore, we suggest that the death toll and quarantine extent can be significantly mitigated if at least part of these strategies are encouraged and implemented by health systems. Given the urgent demand raised by the current uncontrolled pandemic we must be ready to use all the available armamentarium to fight COVID-19.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

We attest no conflict of interest in the manuscript we are submitting entitled “Antimicrobial light-based technologies for management of COVID-19 pandemic crisis”.

Acknowledgements

CPS was supported by the São Paulo Research Foundation (FAPESP, grant 2017/22406-0) and by the Brazilian National Council for Scientific and Technological Development (CNPq, scholarship 141901/2016-0). FPS is supported by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES Finance code 001). ALS is supported by a Marie-Curie Global Fellowship mentored by GPT (EU project 843116 – REBELLION). TD is supported by USA National Institutes of Health (NIH, grant R01AI123312) and by the Department of Defense (DoD, grant FA9550-17-1-0277). MRH is supported by USA National Institutes of Health (NIH, grants R01AI050875 and R21AI121700). MSR thanks Photonics Institute (INCT/CNPq, grant 465763/2014-6) for financial support. MSB acknowledges FAPESP for the CEPID Redoxoma grant 2013/07937-8.

References

1. Zhu N., Zhang D., Wang W. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020;382(8):727–733. [PMC free article] [PubMed[]
2. Huang C., Wang Y., Li X. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497–506. [PMC free article] [PubMed[]
3. Bedford J., Enria D., Giesecke J. COVID-19: towards controlling of a pandemic. Lancet. 2020;395(10229):1015–1018. [PMC free article] [PubMed[]
4. Wells C.R., Sah P., Moghadas S.M. Impact of international travel and border control measures on the global spread of the novel 2019 coronavirus outbreak. Proc. Natl. Acad. Sci. U. S. A. 2020;117(13):7504–7509. [PMC free article] [PubMed[]
5. Xu B., Kraemer M.U.G., Group OC-DC Open access epidemiological data from the COVID-19 outbreak. Lancet Infect. Dis. 2020;20(5):534. []
6. Sohrabi C., Alsafi Z., O’Neill N. World Health Organization declares global emergency: A review of the 2019 novel coronavirus (COVID-19) Int. J. Surg. 2020;76:71–76. [PMC free article] [PubMed[]
7. Lipsitch M., Swerdlow D.L., Finelli L. Defining the Epidemiology of Covid-19 – Studies Needed. N. Engl. J. Med. 2020 doi: 10.1056/NEJMp2002125. [CrossRef[]
8. Zhou F., Yu T., Du R. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet. 2020;395(10229):1054–1062. [PMC free article] [PubMed[]
9. D’Antiga L. Coronaviruses and immunosuppressed patients. The facts during the third epidemic. Liver Transpl. 2020;26(6):832–834. [PubMed[]
10. Wu Z., McGoogan J.M. Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: Summary of a report of 72 314 cases from the Chinese center for disease control and prevention. JAMA. 2020;323(13):1239–1242. []
11. Wu C.N., Xia L.Z., Li K.H. High-flow nasal-oxygenation-assisted fibreoptic tracheal intubation in critically ill patients with COVID-19 pneumonia: a prospective randomised controlled trial. Br. J. Anaesth. 2020;125(1):e166–e168. [PMC free article] [PubMed[]
12. Velavan T.P., Meyer C.G. The COVID-19 epidemic. Tropical Med. Int. Health. 2020;25(3):278–280. []
13. Grasselli G., Pesenti A., Cecconi M. Critical care utilization for the COVID-19 outbreak in Lombardy, Italy: Early experience and forecast during an emergency response. JAMA. 2020 doi: 10.1001/jama.2020.4031. [CrossRef[]
14. Lancet T. COVID-19: protecting health-care workers. Lancet. 2020;395:922. []
15. Liu Y., Eggo R.M., Kucharski A.J. Secondary attack rate and superspreading events for SARS-CoV-2. Lancet. 2020;395 []
16. van Doremalen N., Bushmaker T., Morris D.H. Aerosol and surface stability of SARS-CoV-2 as compared with SARS-CoV-1. N. Engl. J. Med. 2020;382:1564–1567. [PMC free article] [PubMed[]
17. Kampf G., Todt D., Pfaender S., Steinmann E. Persistence of coronaviruses on inanimate surfaces and their inactivation with biocidal agents. J Hosp Infect. 2020;104:246–251. [PMC free article] [PubMed[]
18. Duclaux . 1885. Comptes rendus des séances de la Société de biologie et de ses filiales; p. 395. []
19. Downes A., Blunt T. The influence of light upon the development of bacteria. Nature. 1877;16(218) []
20. Rivers T., Gates F.L. Ultra-Violet Light and Vaccine Virus: II. The effect of monocheomatic Ultra-Violet light upon vaccine virus. J. Exp. Med. 1928;47:45–49. [PMC free article] [PubMed[]
21. Finsen N. Edward Arnold; London: 1901. Phototherapy. []
22. Ackroyd R., Kelty C., Brown N., Reed M. The history of photodetection and photodynamic therapy. Photochem. Photobiol. 2001;74(5):656–669. [PubMed[]
23. Brickner P., Vincent R.L. Ultraviolet germicidal irradiation safety concerns: a lesson from the Tuberculosis Ultraviolet Shelter Study: Murphy’s Law affirmed. Photochem. Photobiol. 2013;89:819–821. [PubMed[]
24. St Denis T., Dai T., Izikson L. All you need is light: antimicrobial photoinactivation as an evolving and emerging discovery strategy against infectious disease. Virulence. 2011;2:509–520. [PMC free article] [PubMed[]
25. Dai T. The antimicrobial effect of blue light: What are behind? Virulence. 2017;8(6):649–652. [PMC free article] [PubMed[]
26. Qiu Y., Li Q., Lee B.E. UV inactivation of human infectious viruses at two full-scale wastewater treatment plants in Canada. Water Res. 2018;147:73–81. [PubMed[]
27. Ben-David A., Sagripanti J.L. A model for inactivation of microbes suspended in the atmosphere by solar ultraviolet radiation. Photochem. Photobiol. 2010;86:895–908. [PubMed[]
28. Abhimanyu Coussens A.K. The role of UV radiation and vitamin D in the seasonality and outcomes of infectious disease. Photochem Photobiol Sci. 2017;16:314–338. [PubMed[]
29. Grant W.B., Lahore H., McDonnell S.L. Vitamin D supplementation could prevent and treat influenza, coronavirus, and pneumonia infections. Preprints. 2020 doi: 10.20944/preprints202003.0235.v1. [CrossRef[]
30. Beck S.E., Rodriguez R.A., Hawkins M.A., Hargy T.M., Larason T.C., Linden K.G. Comparison of UV-Induced Inactivation and RNA Damage in MS2 Phage across the Germicidal UV Spectrum. Appl. Environ. Microbiol. 2015;82(5):1468–1474. [PMC free article] [PubMed[]
32. Kowalski W., Walsh T.J., Petraitis V. COVID-19 Coronavirus Ultraviolet Susceptibility. 2020. 2020. https://www.researchgate.net/publication/339887436_2020_COVID-19_Coronavirus_Ultraviolet_Susceptibility Available at.
33. Darnell M., Subbarao K., Feinstone S.M., Taylor D.R. Inactivation of the coronavirus that induces severe acute respiratory syndrome. SARS-CoV. J Virol Methods. 2004;121:85–91. [PMC free article] [PubMed[]
34. Walker C.M., Ko G. Effect of ultraviolet germicidal irradiation on viral aerosols. Environ Sci Technol. 2007;41(15):5460–5465. [PubMed[]
35. Jordan W.S. The mechanism of spread of Asian influenza. Am Rev Respir Dis. 1961;83(2):29–40. Pt 2. [PubMed[]
36. McDevitt J., Rudnick S.N., Radonovich L.J. Aerosol susceptibility of influenza virus to UV-C light. Appl. Environ. Microbiol. 2012;78:1666–1669. [PMC free article] [PubMed[]
37. Tseng C., Li C.S. Inactivation of viruses on surfaces by ultraviolet germicidal irradiation. J. Occup. Environ. Hyg. 2007;4:400–495. [PMC free article] [PubMed[]
38. Fischer R.J., Morris D.H., van Doremalen N. Assessment of N95 respirator decontamination and re-use for SARS-CoV-2. medRxiv. 2020 doi: 10.1101/2020.04.11.20062018. [CrossRef[]
39. Kyle J., Card K., Dena Crozier D. 2020. UV sterilization of personal protective equipment with idle laboratory biosafety cabinets during the Covid-19 pandemic.https://www.medrxiv.org/content/10.1101/2020.03.25.20043489v2 Available at. []
41. Lilge L., Manalac A., Weersink M. 2020. Light propagation within N95 Filtered Face Respirators: A simulation study for UVC decontamination.https://www.medrxiv.org/content/10.1101/2020.06.12.20129395v2 Available at. []
42. Lindsley W., Martin S.B., Jr., Thewlis R.E. Effects of Ultraviolet Germicidal Irradiation (UVGI) on N95 Respirator Filtration Performance and Structural Integrity. J. Occup. Environ. Hyg. 2015;12:509–517. [PMC free article] [PubMed[]
43. O’Hearn K., Gertsman S., Sampson M. Decontaminating N95 masks with ultraviolet germicidal irradiation (UVGI) does not impair mask efficacy and safety: A Systematic Review. J Hosp Inf. 2020 doi: 10.1016/j.jhin.2020.07.014. [CrossRef[]
44. Song K., Taghipour F., Mohseni M. Microorganisms inactivation by wavelength combinations of ultraviolet light-emitting diodes (UV-LEDs) Sci. Total Environ. 2019;665:1103–1110. [PubMed[]
45. Beck S., Ryu H., Boczek L.A. Evaluating UV-C LED disinfection performance and investigating potential dual-wavelength synergy. Water Res. 2017;109:207–216. [PMC free article] [PubMed[]
46. Welch D., Buonanno M., Grilj V. Far-UVC light: A new tool to control the spread of airborne-mediated microbial diseases. Sci Rep. 2018;8:2752. [PMC free article] [PubMed[]
47. Teles A., Oliveira T.M.A., Bezerra F.C. Photodynamic inactivation of Bovine herpesvirus type 1 (BoHV-1) by porphyrins. J Gen Virol. 2018;99:1301–1306. [PubMed[]
48. Lim M., Lee Y.L., Zhang Y., Chu J.J. Photodynamic inactivation of viruses using upconversion nanoparticles. Biomaterials. 2012;33:1912–1920. [PubMed[]
49. Wiehe A., O’Brien J.M., Senge M.O. Trends and targets in antiviral phototherapy. Photochem Photobiol Sci. 2019;18:2565–2612. [PubMed[]
50. Sobotta L., Skupin-Mrugalska P., Mielcarek J., Goslinski T., Balzarini J. Photosensitizers mediated photodynamic inactivation against virus particles. Mini Rev Med Chem. 2015;15:503–521. [PubMed[]
51. Arenas Y., Monro S., Shi G., Mandel A., McFarland S., Lilge L. Photodynamic inactivation of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus with Ru(II)-based type I/type II photosensitizers. Photodiagn. Photodyn. Ther. 2013;10(4):615–625. []
52. Baptista M.S., Cadet J., Di Mascio P. Type I and Type II Photosensitized Oxidation Reactions: Guidelines and Mechanistic Pathways. Photochem. Photobiol. 2017;93(4):912–919. [PMC free article] [PubMed[]
53. Wainwright M., Maisch T., Nonell S. Photoantimicrobials-are we afraid of the light? Lancet Infect. Dis. 2017;17:e49–e55. [PMC free article] [PubMed[]
54. Tardivo J.P., Wainwright M., Baptista M.S. Local clinical phototreatment of herpes infection in Sao Paulo. Photodiagn. Photodyn. Ther. 2012;9(2):118–121. []
55. Shikowitz M.J., Abramson A.L., Freeman K., Steinberg B.M., Nouri M. Efficacy of DHE photodynamic therapy for respiratory papillomatosis: immediate and long-term results. Laryngoscope. 1998;108(7):962–967. [PubMed[]
56. Casteel M.J., Jayaraj K., Gold A., Ball L.M., Sobsey M.D. Photoinactivation of hepatitis A virus by synthetic porphyrins. Photochem. Photobiol. 2004;80(2):294–300. [PubMed[]
57. Blazquez E., Rodriguez C., Rodenas J. UV-C irradiation is able to inactivate pathogens found in commercially collected porcine plasma as demonstrated by swine bioassay. Vet. Microbiol. 2019;239:108450. [PMC free article] [PubMed[]
58. Eickmann M., Gravemann U., Handke W. 2020. Inactivation of three emerging viruses – severe acute respiratory syndrome coronavirus, Crimean-Congo haemorrhagic fever virus and Nipah virus – in platelet concentrates by ultraviolet C light and in plasma by methylene blue plus visible light. Vox Sang, Crimean-Congo haemorrhagic fever virus and Nipah virus – in platelet concentrates by ultraviolet C light and in plasma by methylene blue plus visible light. Vox Sang. []
59. Wainwright M. Pathogen inactivation in blood products. Curr. Med. Chem. 2002;9(1):127–143. [PubMed[]
60. Marciel L., Teles L., Moreira B. An effective and potentially safe blood disinfection protocol using tetrapyrrolic photosensitizers. Future Med. Chem. 2017;9(4):365–379. [PubMed[]
61. Wagner S.J. Virus inactivation in blood components by photoactive phenothiazine dyes. Transfus. Med. Rev. 2002;16(1):61–66. [PubMed[]
62. Judy M.M. Photodynamic inactivation of enveloped viruses: potential application for blood banking. J. Clin. Laser Med. Surg. 1990;8(4):49–52. [PubMed[]
63. Costa L., Faustino M.A., Neves M.G., Cunha A., Almeida A. Photodynamic inactivation of mammalian viruses and bacteriophages. Viruses. 2012;4(7):1034–1074. [PMC free article] [PubMed[]
64. Floyd R.A., Schneider J.E., Dittmer D.P. Methylene blue photoinactivation of RNA viruses. Antivir. Res. 2004;61(3):141–151. [PubMed[]
65. Costa L., Tomé J.P., Neves M.G. Susceptibility of non-enveloped DNA- and RNA-type viruses to photodynamic inactivation. Photochem Photobiol Sci. 2012;11(10):1520–1523. [PubMed[]
66. Abe H., Wagner S.J. Analysis of viral DNA, protein and envelope damage after methylene blue, phthalocyanine derivative or merocyanine 540 photosensitization. Photochem. Photobiol. 1995;61(4):402–409. [PubMed[]
67. Schneider J.E., Tabatabaie T., Maidt L. Potential mechanisms of photodynamic inactivation of virus by methylene blue. I. RNA-protein crosslinks and other oxidative lesions in Q beta bacteriophage. Photochem. Photobiol. 1998;67(3):350–357. [PubMed[]
68. Rywkin S., Ben-Hur E., Malik Z. New phthalocyanines for photodynamic virus inactivation in red blood cell concentrates. Photochem. Photobiol. 1994;60(2):165–170. [PubMed[]
69. Kasermann F., Kempf C. Photodynamic inactivation of enveloped viruses by buckminsterfullerene. Antivir. Res. 1997;34(1):65–70. [PubMed[]
70. Steinmann E., Gravemann U., Friesland M. Two pathogen reduction technologies–methylene blue plus light and shortwave ultraviolet light–effectively inactivate hepatitis C virus in blood products. Transfusion. 2013;53(5):1010–1018. [PubMed[]
71. Jockusch S., Lee D., Turro N.J., Leonard E.F. Photo-induced inactivation of viruses: adsorption of methylene blue, thionine, and thiopyronine on Qbeta bacteriophage. Proc. Natl. Acad. Sci. U. S. A. 1996;93(15):7446–7451. [PMC free article] [PubMed[]
72. Wagner S.J., Skripchenko A., Robinette D., Foley J.W., Cincotta L. Factors affecting virus photoinactivation by a series of phenothiazine dyes. Photochem. Photobiol. 1998;67(3):343–349. [PubMed[]
73. Korneev D., Kurskaya O., Sharshov K., Eastwood J. Strakhovskaya M. Ultrastructural Aspects of Photodynamic Inactivation of Highly Pathogenic Avian H5N8 Influenza Virus. Viruses. 2019:11(10). []
74. Bacellar I.O.L., Oliveira M.C., Dantas L.S. Photosensitized Membrane Permeabilization Requires Contact-Dependent Reactions between Photosensitizer and Lipids. J. Am. Chem. Soc. 2018;140(30):9606–9615. [PubMed[]
75. Bacellar I.O.L., Baptista M.S. Mechanisms of Photosensitized Lipid Oxidation and Membrane Permeabilization. ACS Omega. 2019;4(26):21636–21646. [PMC free article] [PubMed[]
76. Kurman J., Pastis N., Murgu S. Photodynamic Therapy and Its Use in Lung Disease. Current Pulmonology Reports. 2019;8:215–221. []
77. Agostinis P., Berg K., Cengel K.A. Photodynamic therapy of cancer: an update. CA Cancer J. Clin. 2011;61(4):250–281. [PMC free article] [PubMed[]
78. Geralde M.C., Leite I.S., Inada N.M. Pneumonia treatment by photodynamic therapy with extracorporeal illumination – an experimental model. Physiol Rep. 2017:5(5). []
79. Soares R.B., Costa D.H., Miyakawa W. Photodynamic activity on biofilm in endotracheal tubes of patients admitted to an intensive care unit. Photochem. Photobiol. 2020 doi: 10.1111/php.13239. [CrossRef[]
80. Schikora D., Hepburn J., Plavin S.R. Reduction of the viral load by non-invasive photodynamic therapy in early stages of COVID-19 infection. American Journal of Virology & Disease. 2020;2(1):01–05. []
81. Eleraky N.E., Allam A., Hassan S.B., Omar M.M. Nanomedicine fight against antibacterial resistance: an overview of the recent pharmaceutical innovations. Pharmaceutics. 2020:12(2). []
82. Yin R., Agrawal T., Khan U. Antimicrobial photodynamic inactivation in nanomedicine: small light strides against bad bugs. Nanomedicine (Lond) 2015;10(15):2379–2404. [PMC free article] [PubMed[]
83. Tegou E., Magana M., Katsogridaki A.E. Terms of endearment: Bacteria meet graphene nanosurfaces. Biomaterials. 2016;89:38–55. [PubMed[]
84. Wang Y., Wu X., Chen J. Antimicrobial Blue Light Inactivation of Gram-Negative Pathogens in Biofilms: In Vitro and In Vivo Studies. J. Infect. Dis. 2016;213(9):1380–1387. [PMC free article] [PubMed[]
85. Amin R.M., Bhayana B., Hamblin M.R., Dai T. Antimicrobial blue light inactivation of Pseudomonas aeruginosa by photo-excitation of endogenous porphyrins: In vitro and in vivo studies. Lasers Surg. Med. 2016;48(5):562–568. [PMC free article] [PubMed[]
86. Cieplik F., Spath A., Leibl C. Blue light kills Aggregatibacter actinomycetemcomitans due to its endogenous photosensitizers. Clin. Oral Investig. 2014;18(7):1763–1769. []
87. Dai T., Gupta A., Murray C.K., Vrahas M.S., Tegos G.P., Hamblin M.R. Blue light for infectious diseases: Propionibacterium acnes, Helicobacter pylori, and beyond? Drug Resist. Updat. 2012;15(4):223–236. [PMC free article] [PubMed[]
88. Tomb R.M., White T.A., Coia J.E., Anderson J.G., MacGregor S.J., Maclean M. Review of the Comparative Susceptibility of Microbial Species to Photoinactivation Using 380-480 nm Violet-Blue Light. Photochem. Photobiol. 2018;94(3):445–458. [PubMed[]
89. Bache S.E., Maclean M., MacGregor S.J. Clinical studies of the High-Intensity Narrow-Spectrum light Environmental Decontamination System (HINS-light EDS), for continuous disinfection in the burn unit inpatient and outpatient settings. Burns. 2012;38(1):69–76. [PubMed[]
90. Maclean M., Booth M., Anderson J. Continuous Decontamination of an Intensive Care Isolation Room during Patient Occupancy Using 405 Nm Light Technology. J. Infect. Prev. 2013;14(5):176–181. []
91. Murrell L.J., Hamilton E.K., Johnson H.B., Spencer M. Influence of a visible-light continuous environmental disinfection system on microbial contamination and surgical site infections in an orthopedic operating room. Am. J. Infect. Control. 2019;47(7):804–810. [PubMed[]
92. Kingsley D., Kuis R., Perez R. Oxygen-dependent laser inactivation of murine norovirus using visible light lasers. Virol. J. 2018;15(1):117. [PMC free article] [PubMed[]
93. Wang Y., Murray C.K., Hamblin M.R., Hooper D.C., Dai T. Antimicrobial blue light inactivation of pathogenic microbes: State of the art. Drug Resist. Updat. 2017;33-35:1–22. [PMC free article] [PubMed[]
94. Tomb R.M., Maclean M., Coia J.E. New Proof-of-Concept in Viral Inactivation: Virucidal Efficacy of 405¬†nm Light Against Feline Calicivirus as a Model for Norovirus Decontamination. Food Environ Virol. 2017;9(2):159–167. [PMC free article] [PubMed[]
95. Tomb R.M., Maclean M., Herron P.R., Hoskisson P.A., MacGregor S.J., Anderson J.G. Inactivation of Streptomyces phage C31 by 405 nm light: Requirement for exogenous photosensitizers? Bacteriophage. 2014;4 []
96. Soukos N.S., Stultz J., Abernethy A.D., Goodson J.M. Phototargeting human periodontal pathogens in vivo. Lasers Med. Sci. 2015;30(3):943–952. [PubMed[]
97. Genina E., Titorenko V., Belikov A., Bashkatov A., Tuchin V. Adjunctive dental therapy via tooth plaque reduction and gingivitis treatment by blue light-emitting diodes tooth brushing. J. Biomed. Opt. 2015;20(12):128004. [PubMed[]
98. Ammad S., Gonzales M., Edwards C., Finlay A.Y., Mills C. An assessment of the efficacy of blue light phototherapy in the treatment of acne vulgaris. J. Cosmet. Dermatol. 2008;7(3):180–188. [PubMed[]
99. Yang P., Wang N., Wang C. 460nm visible light irradiation eradicates MRSA via inducing prophage activation. J. Photochem. Photobiol. B. 2017;166:311–322. [PubMed[]
100. Dai T., Gupta A., Huang Y.Y. Blue light rescues mice from potentially fatal Pseudomonas aeruginosa burn infection: efficacy, safety, and mechanism of action. Antimicrob. Agents Chemother. 2013;57(3):1238–1245. [PMC free article] [PubMed[]
101. Fukui M., Yoshioka M., Satomura K., Nakanishi H., Nagayama M. Specific-wavelength visible light irradiation inhibits bacterial growth of Porphyromonas gingivalis. J. Periodontal Res. 2008;43(2):174–178. [PubMed[]
102. Soukos N.S., Som S., Abernethy A.D. Phototargeting oral black-pigmented bacteria. Antimicrob. Agents Chemother. 2005;49(4):1391–1396. [PMC free article] [PubMed[]
103. Liu W., Li H. 2020. COVID-19: Attacks the 1-beta chain of hemoglobin and captures the porphyrin to inhibit human heme metabolism.https://chemrxiv.org/ndownloader/files/22283226 Available at. []
104. de Freitas L.F., Hamblin M.R. Proposed mechanisms of photobiomodulation or low-level light therapy. IEEE J Sel Top Quantum Electron. 2016:22(3). []
105. Karu T. Primary and secondary mechanisms of action of visible to near-IR radiation on cells. J. Photochem. Photobiol. B. 1999;49(1):1–17. [PubMed[]
106. Chung H., Dai T., Sharma S.K., Huang Y.Y., Carroll J.D., Hamblin M.R. The nuts and bolts of low-level laser (light) therapy. Ann. Biomed. Eng. 2012;40(2):516–533. [PMC free article] [PubMed[]
107. Hamblin M.R. Mechanisms and Mitochondrial Redox Signaling in Photobiomodulation. Photochem. Photobiol. 2018;94(2):199–212. [PMC free article] [PubMed[]
108. Da-Palma-Cruz M., da Silva R.F., Monteiro D. Photobiomodulation modulates the resolution of inflammation during acute lung injury induced by sepsis. Lasers Med. Sci. 2019;34(1):191–199. [PubMed[]
109. de Brito A.A., da Silveira E.C., Rigonato-Oliveira N.C. Low-level laser therapy attenuates lung inflammation and airway remodeling in a murine model of idiopathic pulmonary fibrosis: Relevance to cytokines secretion from lung structural cells. J. Photochem. Photobiol. B. 2020;203:111731. [PubMed[]
110. Sergio L.P.D.S., Thomé A.M.C., Trajano L.A.D.S., Mencalha A.L., da Fonseca A.S., de Paoli F. Photobiomodulation prevents DNA fragmentation of alveolar epithelial cells and alters the mRNA levels of caspase 3 and Bcl-2 genes in acute lung injury. Photochem Photobiol Sci. 2018;17(7):975–983. [PubMed[]
111. de Lima F.M., Villaverde A.B., Albertini R. Dual Effect of low-level laser therapy (LLLT) on the acute lung inflammation induced by intestinal ischemia and reperfusion: Action on anti- and pro-inflammatory cytokines. Lasers Surg. Med. 2011;43(5):410–420. [PubMed[]
112. Oliveira M.C., Greiffo F.R., Rigonato-Oliveira N.C. Low level laser therapy reduces acute lung inflammation in a model of pulmonary and extrapulmonary LPS-induced ARDS. J. Photochem. Photobiol. B. 2014;134:57–63. [PubMed[]
113. Costa Carvalho J.L., de Brito A.A., de Oliveira A.P. The chemokines secretion and the oxidative stress are targets of low-level laser therapy in allergic lung inflammation. J. Biophotonics. 2016;9(11–12):1208–1221. [PubMed[]
114. Rigonato-Oliveira N.C., de Brito A.A., Vitoretti L.B. Effect of Low-Level Laser Therapy (LLLT) in Pulmonary Inflammation in Asthma Induced by House Dust Mite (HDM): Dosimetry Study. Int J Inflam. 2019;2019:3945496. [PMC free article] [PubMed[]
115. Yu W., Chi L.H., Naim J.O., Lanzafame R.J. Improvement of host response to sepsis by photobiomodulation. Lasers Surg. Med. 1997;21(3):262–268. [PubMed[]
116. Rola P., Doroszko A., Szahidewicz-Krupska E. Low-Level Laser Irradiation Exerts Antiaggregative Effect on Human Platelets Independently on the Nitric Oxide Metabolism and Release of Platelet Activation Markers. Oxidative Med. Cell. Longev. 2017;2017:6201797. []
117. Klok F.A., Kruip M.J.H.A., van der Meer N.J.M. Incidence of thrombotic complications in critically ill ICU patients with COVID-19. Thromb. Res. 2020;191:145–147. [PMC free article] [PubMed[]
118. Sekhejane P.R., Houreld N.N., Abrahamse H. Irradiation at 636 nm positively affects diabetic wounded and hypoxic cells in vitro. Photomed. Laser Surg. 2011;29(8):521–530. [PubMed[]
119. Caputo N.D., Strayer R.J., Levitan R. Early Self-Proning in Awake, Non-intubated Patients in the Emergency Department: A Single ED’s Experience During the COVID-19 Pandemic. Acad. Emerg. Med. 2020;27(5):375–378. [PMC free article] [PubMed[]
120. Cassano P., Caldieraro M.A., Norton R. Reported Side Effects, Weight and Blood Pressure, After Repeated Sessions of Transcranial Photobiomodulation. Photobiomodul Photomed Laser Surg. 2019;37(10):651–656. [PubMed[]
121. Hamblin M.R., Nelson S.T., Strahan J.R. Photobiomodulation and Cancer: What Is the Truth? Photomed. Laser Surg. 2018;36(5):241–245. [PMC free article] [PubMed[]
122. Tsen K., Tsen S.W.D., Chang C.L., Hung C.F., Wu T.C., Kiang J.G. Inactivation of viruses by coherent excitations with a low power visible femtosecond laser. Virol. J. 2007;50 []
123. Tsen K.T., Tsen S.W., Fu Q. Photonic approach to the selective inactivation of viruses with a near-infrared subpicosecond fiber laser. J. Biomed. Opt. 2009;14(6) []
124. Tsen K.T., Tsen S.W., Fu Q. Studies of inactivation of encephalomyocarditis virus, M13 bacteriophage, and Salmonella typhimurium by using a visible femtosecond laser: insight into the possible inactivation mechanisms. J. Biomed. Opt. 2011;16(7) []
125. Tsen S.W.D., Chapa T., Beatty W., Tsen K.T., Yu D., Achilefu S. Inactivation of enveloped virus by laser-driven protein aggregation. J Biomed Opt. 2012;17(12) []
126. Tsen S.W., Kingsley D.H., Poweleit C. Studies of inactivation mechanism of non-enveloped icosahedral virus by a visible ultrashort pulsed laser. Virol. J. 2014;11:20. [PMC free article] [PubMed[]
127. Tsen S.W., Kingsley D.H., Kibler K. Pathogen reduction in human plasma using an ultrashort pulsed laser. PLoS One. 2014;9(11) []
128. Tsen S.W., Donthi N., La V. Chemical-free inactivated whole influenza virus vaccine prepared by ultrashort pulsed laser treatment. J. Biomed. Opt. 2015;20(5) []

Radiation Fibrosis Syndrome

Photobiomodulation Therapy to Mitigate Radiation Fibrosis Syndrome

Affiliations 

Affiliations

  • 1Department of Radiation Oncology, School of Medicine, New York University, New York, New York, USA.
  • 2Department of Radiation Oncology, New York University Perlmutter Cancer Center, New York, New York, USA.
  • 3Department of Oral Biology, School of Dental Medicine, University at Buffalo, Buffalo, New York, USA.
  • 4Department of Biomedical Engineering, School of Engineering and Applied Sciences, University at Buffalo, Buffalo, New York, USA.
  • 5Faculty of Medicine and Life Sciences, Hasselt University, Hasselt, Belgium.
  • 6Associate Dean for Translational Research, University of Pennsylvania of Dental Medicine, Philadelphia, Pennsylvania, USA.

Abstract

Objective: We evaluated the role of photobiomodulation (PBM) in radiation fibrosis syndrome (RFS).

Background: Radiation therapy (RT) is an important treatment utilized in over half of newly diagnosed cancers. Despite its benefits, patients treated with RT may experience acute and chronic significant side effects depending on both treatment- and patient-related factors. RFS is an important long-term side effect of RT, which can adversely impact patient’s quality of life and organ function. With improved oncologic outcomes and survival for cancer patients after radiation, there is an unmet need to address long-term side effects of RT, particularly RFS.

Results: Photobiomodulation (PBM) using low energy, nonionizing light primarily in the visible (especially red) or near-infrared spectrum has been demonstrated to decrease acute side effects of radiation in rigorously conducted phase III randomized studies; however, its potential benefit in ameliorating chronic radiation side effects, particularly RFS remains to be investigated.

Conclusions: This review summarizes the in vitro data, preclinical animal studies and clinical reports, which showcase the potential benefits of PBM treatments in preventing and reversing RFS.

Keywords: photobiomodulation (PBM); radiation fibrosis syndrome (RFS); radiation therapy.

Presets for the Curatron 2000 PC

                                Standard Disorders
Acne Irritable Bowel Syndrome Stomach relaxation
ADHD Kidney resonance Stress
Alzheimer Liver resonance Stroke recovery
Ankylosing spondylitis Low back pain Tendinitis
Anxiety Lupus Thigh neuralgia
Arthritis Lyme disease Tinnitus
Atherosclerosis Macular degeneration Tonsillitis
Asthma Metabolic deficiency Torn muscles
Athletic fatigue Migraine Trigeminus neuralgia
Autism Migrainous neuralgia Varicose veins
Backache Morbus Bechterew Vitalization
Brachial neuralgia Morbus Sudeck Wellness
Bronchitis Neuritis Wound healing
Burns Neuropathy
Bursitis Neurosclerosis Brain Disorders
Carpal tunnel syndrome Neurosis High intensity 5 min.
Cartilage regrowth Neurovegetative somatic symptoms Alzheimer
Cervical arthritis Oedema Depression
Cervical myalgic headaches Osteoarthritis Neuropathic pain
Charcot-Marie-Tooth neuropathy Osteoporosis Parkinson
Concussion Osteomyelitis Post traumatic stress
Cervico brachialgia Oxygenation Smoking cessation
Coxarthrosis Pain therapy
Coxitis Pancreatitis LLLT Combo Probe
Complex regional pain syndrome Periarthritis High intensity 5 min.
Contusions Phlebitis High intensity 10 min.
Crohn’s disease Phobia High intensity 15 min.
Decubitus Post radiotherapy treatment Medium intensity 5 min.
Delayed fracture healing Prostatitis Medium intensity 10 min.
Dental treatment Prostate hypertrophy Medium intensity 15 min.
Dermatitis Pseudo arthrosis Low intensity 5 min.
Diabetes Psoriasis Low intensity 10 min.
Dislocations Relaxation Low intensity 15 min.
Epicondylitis Relaxation EEG waves
Eczema Retinitis Custom Disorders
Facial neuralgia Rheumatoid arthritis (List your custom protocols)
Fibromyalgia Rosacea
Fractures Sacral arthritis
Gonarthrosis Scars
Herpes Sciatica
Hallux valgus bursitis Sedation
Heart Sinusitis
Intercostal neuralgia Sleep disturbances
Intramuscular fibrosis Spastic colon
Internal injuries Spinal stenosis

Ankylosing Spondylitis

Lasers Med Sci. 2016 Apr;31(3):459-69. doi: 10.1007/s10103-016-1874-2. Epub 2016 Jan 21.

LLLT for the management of patients with ankylosing spondylitis.

Stasinopoulos D1, Papadopoulos K2, Lamnisos D1, Stergioulas A3.

Author information

1
Physiotherapy Program, Department of Health Sciences, School of Sciences, European University Cyprus, Laureate International Universities, 6 Diogenes Street, 2044, Engomi, Nicosia, Cyprus.
2
Physiotherapy Program, Department of Health Sciences, School of Sciences, European University Cyprus, Laureate International Universities, 6 Diogenes Street, 2044, Engomi, Nicosia, Cyprus. kostpap@yahoo.com.
3
Lab of Health, Fitness and Disability Management, Faculty of Human Movement and Quality of Life, University of Peloponnese, Efstathiou & Stamatikis Balioti & Plateon, 231 00, Sparta, Laconia, Greece.

Abstract

This study aimed to compare the effectiveness of the combined lowlevel laser therapy (LLLT) and passive stretching with combined placebo LLLT laser and the same passive stretching exercises in patients suffering from ankylosing spondylitis. Forty-eight patients suffering from ankylosing spondylitis participated in the study and were randomized into two groups. Group A (n=24) was treated with a wavelength = 820 Ga-Al-As laser CW, with power intensity = 60 mW/cm(2), energy per point in each session = 4.5 J, total energy per session =27.0 J, in contact with specific points technique, plus passive stretching exercises. Group B (n = 24), received placebo laser plus the same passive stretching exercises. Both groups received 12 sessions of laser or placebo within 8 weeks; two sessions per week (weeks 1-4) and one session per week (weeks 5-8). Pain and function scales were completed before the treatment, at the end of the fourth and eighth week of treatment, and 8 weeks after the end of treatment (follow-up). Group A revealed a significant improvement after 8 weeks of treatment in all pain and function scales. At 8-week follow-up, the improvement remained only for the pain, while for all other function outcomes the differences were not statistically significant. The results suggested that after an 8-week treatment and after a follow-up, the combination of LLLT and passive stretching exercises decreased pain more effectively than placebo LLLT along with the same passive stretching exercises in patients with ankylosing spondylitis. Future studies are needed to establish the relative and absolute effectiveness of the above protocol.

KEYWORDS:

Ankylosing spondylitis; LLLT; Passive stretching

Distribution of Laser Diodes

Diagram of Laser Diode Distribution

The wavelength, distribution and relatively gentle maximum output power of PowerTwin’s laser diodes are designed for maximum biostimulation and tissue healing, delivering 18 Joules per laser diode with an average energy density of 7 Joules/Cm2 in 3 minutes over the 55 Cm2 beam area at the continuous wave default setting.

Stem Cells

Stem Cell Res Ther. 2018 May 21;9(1):143. doi: 10.1186/s13287-018-0883-4.

Extremely low frequency electromagnetic fields promote mesenchymal stem cell migration by increasing intracellular Ca2+ and activating the FAK/Rho GTPases signaling pathways in vitro.

Zhang Y1, Yan J1, Xu H1, Yang Y1, Li W1, Wu H2, Liu C3.

Author information

1
Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Avenue 1095, Wuhan, 430030, China.
2
Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Avenue 1095, Wuhan, 430030, China. wuhua360@aliyun.com.
3
Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Avenue 1095, Wuhan, 430030, China. liu.chaoxu@tjh.tjmu.edu.cn.

Abstract

BACKGROUND:

The ability of mesenchymal stem cells (MSCs) to migrate to the desired tissues or lesions is crucial for stem cell-based regenerative medicine and tissue engineering. Optimal therapeutics for promoting MSC migration are expected to become an effective means for tissue regeneration. Electromagnetic fields (EMF), as a noninvasive therapy, can cause a lot of biological changes in MSCs. However, whether EMF can promote MSC migration has not yet been reported.

METHODS:

We evaluated the effects of EMF on cell migration in human bone marrow-derived MSCs. With the use of Helmholtz coils and an EMF stimulator, 7.5, 15, 30, 50, and 70 Hz/1 mT EMF was generated. Additionally, we employed the L-type calcium channel blocker verapamil and the focal adhesion kinase (FAK) inhibitor PF-573228 to investigate the role of intracellular calcium content, cell adhesion proteins, and the Rho GTPase protein family (RhoA, Rac1, and Cdc42) in EMF-mediated MSC migration. Cell adhesion proteins (FAK, talin, and vinculin) were detected by Western blot analysis. The Rho GTPase protein family activities were assessed by G-LISA, and F-actin levels, which reflect actin cytoskeletal organization, were detected using immunofluorescence.

RESULTS:

All the 7.5, 15, 30, 50, and 70 Hz/1 mT EMF promoted MSC migration. EMF increased MSC migration in an intracellular calcium-dependent manner. Notably, EMF-enhanced migration was mediated by FAK activation, which was critical for the formation of focal contacts, as evidenced by increased talin and vinculin expression. Moreover, RhoA, Rac1, and Cdc42 were activated by FAK to increase cytoskeletal organization, thus promoting cell contraction.

CONCLUSIONS:

EMF promoted MSC migration by increasing intracellular calcium and activating the FAK/Rho GTPase signaling pathways. This study provides insights into the mechanisms of MSC migration and will enable the rational design of targeted therapies to improve MSC engraftment.

KEYWORDS:

Cell migration; Electromagnetic fields; Focal adhesion kinase; Intracellular Ca2+?; Rho GTPase protein famil

Int J Mol Sci. 2018 Mar 27;19(4). pii: E994. doi: 10.3390/ijms19040994.

Co-Culture with Human Osteoblasts and Exposure to Extremely Low Frequency Pulsed Electromagnetic Fields Improve Osteogenic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells.

Ehnert S1, van Griensven M2, Unger M3, Scheffler H4, Falldorf K5, Fentz AK6, Seeliger C7, Schröter S8, Nussler AK9, Balmayor ER10.

Author information

1
Siegfried Weller Institute for Trauma Research, Eberhard-Karls-Universität Tübingen, 72076 Tübingen, Germany. sabrina.ehnert@med.uni-tuebingen.de.
2
Experimental Trauma Surgery, Klinikum rechts der Isar, Technical University of Munich, 81675 München, Germany. martijn.vangriensven@tum.de.
3
Experimental Trauma Surgery, Klinikum rechts der Isar, Technical University of Munich, 81675 München, Germany. marina.unger@tum.de.
4
Siegfried Weller Institute for Trauma Research, Eberhard-Karls-Universität Tübingen, 72076 Tübingen, Germany. hscheffler@bgu-tuebingen.de.
5
Sachtleben GmbH, 20251 Hamburg, Germany. falldorf@citresearch.de.
6
Sachtleben GmbH, 20251 Hamburg, Germany. fentz@citresearch.de.
7
Experimental Trauma Surgery, Klinikum rechts der Isar, Technical University of Munich, 81675 München, Germany. claudine.seeliger@tum.de.
8
Siegfried Weller Institute for Trauma Research, Eberhard-Karls-Universität Tübingen, 72076 Tübingen, Germany. sschroeter@bgu-tuebingen.de.
9
Siegfried Weller Institute for Trauma Research, Eberhard-Karls-Universität Tübingen, 72076 Tübingen, Germany. andreas.nuessler@med.uni-tuebingen.de.
10
Experimental Trauma Surgery, Klinikum rechts der Isar, Technical University of Munich, 81675 München, Germany. elizabeth.rosado-balmayor@tum.de.

Abstract

Human adipose-derived mesenchymal stem cells (Ad-MSCs) have been proposed as suitable option for cell-based therapies to support bone regeneration. In the bone environment, Ad-MSCs will receive stimuli from resident cells that may favor their osteogenic differentiation. There is recent evidence that this process can be further improved by extremely low frequency pulsed electromagnetic fields (ELF-PEMFs). Thus, the project aimed at (i) investigating whether co-culture conditions of human osteoblasts (OBs) and Ad-MSCs have an impact on their proliferation and osteogenic differentiation; (ii) whether this effect can be further improved by repetitive exposure to two specific ELF-PEMFs (16 and 26 Hz); (iii) and the effect of these ELF-PEMFs on human osteoclasts (OCs). Osteogenic differentiation was improved by co-culturing OBs and Ad-MSCs when compared to the individual mono-cultures. An OB to Ad-MSC ratio of 3:1 had best effects on total protein content, alkaline phosphatase (AP) activity, and matrix mineralization. Osteogenic differentiation was further improved by both ELF-PEMFs investigated. Interestingly, only repetitive exposure to 26 Hz ELF-PEMF increased Trap5B activity in OCs. Considering this result, a treatment with gradually increasing frequency might be of interest, as the lower frequency (16 Hz) could enhance bone formation, while the higher frequency (26 Hz) could enhance bone remodeling.

KEYWORDS:

extremely low frequency pulsed electromagnetic fields (ELF-PEMF); primary human adipose-derived mesenchymal stem cells (Ad-MSCs); primary human osteoblasts (OBs); primary human osteoclasts (OCs)

Logo of scirep

About Editorial Board For Authors Scientific Reports
Sci Rep. 2018; 8: 5108.
Published online 2018 Mar 23. doi:  10.1038/s41598-018-23499-9
PMCID: PMC5865106
PMID: 29572540

Pulsed electromagnetic fields increase osteogenetic commitment of MSCs via the mTOR pathway in TNF-? mediated inflammatory conditions: an in-vitro study

Letizia Ferroni,1 Chiara Gardin,1 Oleg Dolkart,corresponding author2 Moshe Salai,2 Shlomo Barak,3 Adriano Piattelli,4 Hadar Amir-Barak,5and Barbara Zavan1
1Department of Biomedical Sciences, University of Padova, Via G. Colombo 3, 35100 Padova, Italy
2Division of Orthopaedic Surgery, Tel Aviv Sourasky Medical Center, Tel Aviv University Sackler Faculty of Medicine, Tel Aviv, Israel
3Private Practice, Tel Aviv, Israel
4Department of Medical, Oral, and Biotechnological Sciences, University of Chieti-Pescara, Chieti, Italy
5Department of Internal Medicine E, Tel Aviv Sourasky Medical Center, Tel Aviv University Sackler Faculty of Medicine, Tel Aviv, Israel
Oleg Dolkart, moc.liamg@otraklod.
corresponding authorCorresponding author.
Author information ? Article notes ? Copyright and License information ? Disclaimer
Received 2017 Jul 11; Accepted 2018 Mar 14.

Abstract

Pulsed electromagnetic fields (PEMFs) have been considered a potential treatment modality for fracture healing, however, the mechanism of their action remains unclear. Mammalian target of rapamycin (mTOR) signaling may affect osteoblast proliferation and differentiation. This study aimed to assess the osteogenic differentiation of mesenchymal stem cells (MSCs) under PEMF stimulation and the potential involvement of mTOR signaling pathway in this process. PEMFs were generated by a novel miniaturized electromagnetic device. Potential changes in the expression of mTOR pathway components, including receptors, ligands and nuclear target genes, and their correlation with osteogenic markers and transcription factors were analyzed. Involvement of the mTOR pathway in osteogenesis was also studied in the presence of proinflammatory mediators. PEMF exposure increased cell proliferation and adhesion and the osteogenic commitment of MSCs even in inflammatory conditions. Osteogenic-related genes were over-expressed following PEMF treatment. Our results confirm that PEMFs contribute to activation of the mTOR pathway via upregulation of the proteins AKT, MAPP kinase, and RRAGA, suggesting that activation of the mTOR pathway is required for PEMF-stimulated osteogenic differentiation. Our findings provide insights into how PEMFs influence osteogenic differentiation in normal and inflammatory environments.

Introduction

Pulsed electromagnetic fields (PEMFs) have long been known to accelerate fracture repair. Exposure to PEMFs has been shown to affect cell proliferation and differentiation by influencing multiple metabolic pathways, depending upon lineage and maturation stage. In the osteoblast lineage, PEMFs contribute to bone formation induced by a demineralized bone matrix and stimulate fracture healing, probably through the action of progenitors that are already committed towards bone. Data on the mechanism of action of PEMFs and the potential involvement of specific signal transduction pathways are, however, scarce. It has been reported that PEMFs increase the activity of certain kinases belonging to known intracellular signaling pathways, such as the protein kinase A (PKA) and the MAPK ERK1/2,, and that they modulate anti-inflammatory effects by increasing the quantity of the adenosine receptors A2A. PEMFs stimulation also upregulates BMP2 expression in association with increased differentiation in mesenchymal stem cells (MSCs),.

Dental implants and total joint replacements are surgical procedures that involve the implantation of permanent biomaterials. An increasing number of these procedures has been extended to younger and middle-age patients, making long-standing biocompatibility, robustness and functionality crucial requirements for these implants. Despite many recent advances, revision surgeries of the implants continue to be a major concern due to the tissue response induced by implanted biomaterials, as well as the potential for loosening and periprosthetic osteolysis which remain significant challenges.

The basis of recent insights into osseointegration range from the pure bone healing that takes place around the implant to an immune-mediated foreign body reaction. That reaction involves a sequence of events, including protein adsorption on the surface of the implant, activation of complement and the coagulation system, recruitment of monocyte/macrophages and MSCs, activation and differentiation of these cells into functional macrophages, osteoclasts, and osteoblasts, respectively, and the formation of biological attachments between implant and new bone. The continued release of wear debris from the implants and the potential evolving infection during the lifespan of the implant might induce peri-implant inflammation, resulting in peri-implant osteolysis, aseptic loosening and subsequent implant failure necessitating further surgical intervention.

Serine/threonine kinase mammalian target of rapamycin (mTOR) has been shown to play an important role in osteoclast differentiation. It is activated by macrophage colony-stimulating factor, and its inhibition leads to decreased osteoclastogenesis,. Furthermore, mTOR expression levels are higher at the earlier stages of osteoclastogenesis and decrease at the later stages of osteoclast formation. mTOR exists in cells as part of two complexes: complex 1 (mTORC1) and complex 2 (mTORC2). mTORC1 is activated by amino acids, growth factors, oxygen, inflammation, and Wnt signaling. mTORC1 is also a negative regulator of autophagy, a lysosomal degradation process responsible for the removal of long-lived proteins and damaged organelles,. It has also been confirmed that the mTOR signaling pathway was involved in the regulation of apoptosis and autophagy in MSCs, and that its inhibition is able to attenuate age-related changes in MSCs.

This study aimed to assess the potential involvement of the mTOR signaling pathway in the osteogenic differentiation of MSCs, the cells naturally involved in bone repair processes, under stimulation with PEMFs. To this end, we analyzed potential changes in the expression of mTOR signaling pathway components, including receptors, ligands and nuclear target genes, and their correlation with osteogenic markers and transcription factors. PEMFs were generated using a miniaturized electromagnetic device (MED) (Magdent Ltd., Tel Aviv, Israel) that is used successfully to stimulate implant osseointegration in the clinical setting and in vivo to. The involvement of mTOR pathway in osteogenesis was also studied in the presence of proinflammatory mediators.

Results

Proliferation

The biocompatibility of the surface was evaluated by MTT testing for measuring mitochondria activity as well as by evaluating cell numbers. Figure 1A displays the results of MTT testing conducted in normal conditions and in the presence of proinflammatory cytokines. Mitochondrial activity increased over time in both the control and PEMF groups. The presence of inflammatory cytokines caused a well-defined decrease in MTT values. The same pattern of increased cell proliferation was demonstrated by monitoring the cell numbers (Fig. 1B). Specifically, fewer cells were found in inflammatory conditions. Moreover, PEMF treatment was able to increase cell proliferation in both conditions. The proliferation rate was significantly higher in the PEMF group compared to the controls, even in an inflammatory environment.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig1_HTML.jpg

MSCs subjected to PEMF irradiation in the presence of proinflammatory cytokines for 30 days. (A) MTT proliferation assay. Results are expressed as mean?±?SD of at least 3 independent experiments, *p?<?0.05. (B) DNA content quantification. Results are expressed as mean?±?SD of at least 3 independent experiments, *p?<?0.05.

Morphology and cell adhesion properties

Morphologic analyses of MSCs were performed. Phalloidin-labeled F-actin (red), DAPI nuclear staining (blue) and overlaid fluorescent image of immunostained cellular components (merged) for the MSCs of the control and PEMF-treated groups are seen in Fig. 2. As shown in Fig. 2, the cells were able to attach to the implant surface in both the PEMF and control groups. The number of cells present on the implant surface with PEMF was clearly higher compared to the number of cells in the control group.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig2_HTML.jpg

Morphologic analyses of MSCs. Phalloidin-labeled F-actin (red), DAPI nuclear staining (blue) and overlaid fluorescent image of immunostained cellular components (merged) for the MSCs of the control and PEMF-treated groups. After 7 days of culture, the cells were well-colonized throughout the implant surface, demonstrating a star-like shape associated with osteoblastic features. The cells were also able to spread after 7 days. PEMF irradiation resulted in a greater number of cells that were attached to the surfaces.

Cell adhesion properties were assessed by the analyses of gene expression of molecules involved on hyaluronan synthesis (HAS1), including receptor for extracellular hyaluronic acid molecules (CD44), integrin (ITGA1, 2, 3, 4), and cell adhesion molecules of the cadherine family, such as NCAM, VCAM, and PCAM (Fig. 3). The results are reported in all the graphs as an increase of gene expression value in samples of cells cultured in control conditions compared to cells exposed to PEMFs. PEMFs generated by MED were able to induce an increase in the expression of all these molecules, thereby confirming that they may enhance the adhesion properties of the cells. The presence of inflammatory stimuli (Fig. 3B) resulted in a reduction of cell adhesion, however, the presence of a PEMF significantly increased the expression of the integrin and cadherin receptors, thus potentially improving the ability of the cell to attach to the surface.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig3_HTML.jpg

Analyses of cell adhesion properties in normal conditions (A) and in the presence of inflammation (B) were conducted by searching for the expression of molecules involved in hyaluronian synthesis (HAS1), i.e., extracellular receptor for hyaluronic acid (CD44), integrin (ITGA1, 2, 3, 4), and cadherin family cell adhesion molecules (NCAM; VCAM; PCAM). The results are reported as an increase in the gene expression value in samples of cells cultured on implants with MED device compared to the same gene expression obtained in normal conditions.

Osteogenic process

Real-time PCR for principal osteogenic markers, such as Runx, osteopontin, osteonectin, osteocalcin, collagen type I, wnt, foxO, ALP, BMP2, and BMP7 was performed in order to evaluate the commitment of MSCs onto osteoblastic phenotypes. The cells were cultured in the presence (Fig. 4A) and in the absence of inflammatory conditions (Fig. 4B) in order to compare the variations obtained in the control group with those obtained in the PEMF group. As illustrated in Fig. 4, in all the conditions an increase in expression of all osteogenic markers was noticed, confirming that the presence of PEMF exerts a positive effect on this process even in the presence of inflammatory cytokines. This commitment was confirmed by quantified ALP activity when MSCs were cultured in both the control and PEMF groups in the presence and absence of inflammatory stimuli (Fig. 5). Additionally, PEMFs were also able to induce a positive effect on the osteogenic process. It was clear that MSCs were also able to produce higher values of ALP in the presence of inflammatory cytokines as well. There was a significant, time-dependent ALP activity for cells grown under PEMF treatment, demonstrating the promotion of the crystallization of hydroxyapatites, a typical feature of pre-osteoblastic cells.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig4_HTML.jpg

Real-time PCR for principal osteogenic markers, such as Runx, osteopontin, osteonectin, osteocalcin, collagen type I, wnt, foxO, ALP, BMP2, and BMP7 was performed in order to evaluate the commitment of stem cells onto an osteoblastic phenotype. The cells were cultured in the (A) presence and (B) absence of inflammatory conditions, and the variations obtained in normal implants versus implants?+?MED were compared.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig5_HTML.jpg

Quantification of intracellular ALP activity (expressed as U/mL) in MSC exposed to PEMFs and in non-exposed MSC in the presence and absence of an inflammatory environment at 15 and 30 days. Results are expressed as mean?±?SD of at least 3 independent experiments, *p?<?0.05. *; **p?=?0.01; ***p?=?0.001.

mTOR pathway

In order to test if PEMF is able to excerpt its osteogenic properties thought mTOR pathway we used rapamicin to verify following hypothesis:

  1. rapamicin is able to reduce the osteogenic properties in absence of PEMF(control);
  2. The exposure to PEMF in presence of rapamicin could restore the osteogenic commitment of MSCs.

The osteogenic properties of MSCs seeded in the osteogenic medium have been evaluated as their ability to produce a mineralized extracellular matrix by means the ARS test. Figure 6 reports the staining on implant (A); on the medium (B) and the quantification of ARS staining (C). The osteogenic potential is related to the ability to produce a mineralized matrix. Higher values of mineralization are represented by a greater values of the red staining (Fig. 6A,B). Spectroscopy was used to assess these parameters. The quantification of the osteogenic potential is reported in Fig. 6C. It is well evident that both in normal condition (passive implant) and in presence of PEMF (active implant) a decent quantity of ARS is detectable at the time frame of 7 to 14?days. When Rapamicin was added, a well-defined decline was noticed, predominantly at 14 days in passive condition. On the contrary, in presence of PEMF, Rapamicin was not able to inhibit the process and mineralization of the extracellular environment was demonstrated.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig6_HTML.jpg

The osteogenic properties of MSCs seeded in the osteogenic medium have been evaluated as their ability to produce a mineralized extracellular matrix by means the ARS test. staining on implant (A); on the medium (B) and the quantification of ARS staining (C). Results are expressed as mean?±?SD of at least 3 independent experiments, **p?=?0.01.

Similar phenomenon was observed at gene expression level as well. In Figs 7 and ?and88 we report the gene expression of markers related to mTOR pathway evaluated at 14 day on MSCs cultures seeded in osteogenic medium with rapamicin, with or without PEMF treatment (passive VS active implant). Results have been grouped in correlation to their involvement in mTOR pathway: mTOR1 Complexes; mTOR2 Complexes; mTOR Upstream Regulators – negative regulation; mTOR Upstream Regulators – positive regulation; mTOR Downstream Regulators – negative regulation; mTOR Downstream Regulators – positive regulation. The results were analyzed and are presented as the ratio between: active implant in osteogenic medium?+?rapamicin with the active implant in osteogenic medium without rapamicin; passive implant in osteogenic medium?+?rapamicin with the passive implant in osteogenic medium without rapamicin. Value comprises from ?2 to +2 are related to no significant variation. All genes related to the ratio in presence of a PEMF (active implant) are from ?2 to +2, indicating that no difference occurs in co-presence of rapamicine and PEMF. On the contrary in absence of PEMF defined up or dowregulation to gene related to mTOR1 involved mostly in Adipogenic commitment rather than osteogenic commitment of MSCs were demonstrated.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig7_HTML.jpg

Gene expression of mTOR activity: (A) positive regulator, (B) negative regulator. (C) downstream effector: positive regulation, and (D) downstream effector: negative regulation.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig8_HTML.jpg

Real-time PCR analysis of mTOR pathway markers. Gene expression levels of the selected markers are reported as ration of MSC coltured on active implants in presence of osteogenic medium and Rapamicin implants with passive implants in presence of osteogenic medium and Rapamicin. Results are expressed as mean?±?SD of at least 3 independent experiments, **p?=?0.01.

In order to highlight genes responsive to the PEMF stimulus we analyzed also the results related to the ratio of gene expression of active implant in presence of osteogenic medium plus rapamicin with the passive implant in osteogenic medium?+?rapamicine (Fig. 7).

As reported in Fig. 8, a significant difference was found in presence of PEMF and is related to:

  • •Decrease in RICTOR (receptor for mTOR2)
  • •Decrease in Protein phosphatase 2, regulatory subunit B, beta (PPP2R2B) involved on mTOR2 pathway
  • •Decrease in PKC protein (involved on Adipogenesis)
  • •Increase on VEGF (involved on angiogenesis)
  • •Decrease in Upstream regulator of negative mTOR regulator:

Protein kinase, AMP-activated, beta 1 non-catalytic subunit (PRKAB1)

Protein kinase, AMP-activated, beta 2 non-catalytic subunit (PRKAB2)

Protein kinase, AMP-activated, gamma 3 non-catalytic subunit (PRKAG3)

  • •Decrease in downstream stream regulator of negative mTOR regulator:

Calcium binding protein 39-like (CAB39L)

DNA-damage-inducible transcript 4 (DDIT4)

DNA-damage-inducible transcript 4-like (DDIT4L)

STE20-related kinase adaptor beta (STRADB)

The results indicated that PEMFs enhance mTOR signaling by inducing an increase in the value of its related proteins, such as AKT, MAPP kinase, and RRAGA. Additionally, a significant increase in Rho family of GTPases was detected. Rho family members play crucial roles in mechanical signal transduction and promote the differentiation of MSCs into osteoblasts.

Interleukin expression

MSCs were treated with PEMF in the presence of inflammatory cytokines as well as in the presence of PEMF. The results of their effect on inflammatory/anti-inflammatory activities of a PEMF are shown in Fig. 9, and they indicate that the presence of a PEMF induced a significant increase of in vitro expression of IL-10 (that exerts anti-inflammatory activity). Conversely, there was a reduction of expression of pro-inflammatory cytokines, such as IL-1, following PEMF treatment. There was no significant difference in expression of the other selected cytokines.

An external file that holds a picture, illustration, etc. Object name is 41598_2018_23499_Fig9_HTML.jpg

MSC were treated with inflammatory cytokines in the presence and absence of PEMFs. The results of the effect on inflammatory/anti-inflammatory activities of the active implants on MSC indicate a significant increase of in vitro expression of IL-10 (that exerts anti-inflammatory activity) in the presence of PEMFs generated by the MED device. Conversely, there is a reduction of expression of inflammatory cytokines, such as IL-1, in the presence of PEMFs. No significant difference in the expression of the other tested cytokines is evident.

Discussion

The principal results of the present study revealed several novel findings regarding the events involved in the stimulation of the osteogenic differentiation of MSCs induced by PEMFs. They identified a significant role of mTOR signaling during the differentiation driven by PEMF stimulation in an osteogenic microenvironment. Additionally, PEMFs were able to preserve the proliferation rate of MSCs in inflammatory conditions equal to that in a normal environment. MED-induced PEMF treatment resulted in an immunomodulatory effect in MSCs as expressed by increased IL-10 secretion. We found that PEMF stimulation of MSC proliferation mainly affected cell cycle regulation, cell structure, extracellular matrix, and some growth receptors involved in kinase pathways.

The osteointegration process begins with an inflammatory stage followed by the migration of MSCs. One of the major goals of dental, orthopedic and maxillofacial surgery is to achieve good and rapid osteointegration between implants and bone. The main research strategies to reduce implant failure aim at improving biomaterial characteristics, or stimulating bone endogenous repair, through a careful assessment of both processes by means of in vitro and in vivo experimental models before any application in humans. It had been reported that MED-generated PEMFs stimulated early bone formation around dental implants, already resulting in higher peri-implant bone-implant contact and bone mass after only 2 weeks, which suggests an acceleration of the osseointegration process by more than 3-fold. However, the exact biologic mechanism of the influence of PEMFs on bone regeneration remains to be elucidated. A recent study by Ferroni et al. concluded that PEMFs affect the osteogenic differentiation of MSCs only if they are pre-committed, and that this therapy can be an appropriate candidate for the treatment of conditions requiring an acceleration of the repair process.

We raised two major questions concerning the PEMF-related mechanism in the current study. First, we looked into the effects of PEMFs on MSCs in an inflammatory environment with regard to the ability of the cells to proliferate and adapt to the immunomodulatory changes. Understanding the mechanism of the implant’s integration, particularly the inflammatory response, is relevant for finding new treatment modalities to optimize the osteointegration and subsequent stability of the implants, which have implications in dentistry and orthopedic surgery. In this study, we added pro- and anti-inflammatory cytokines, which simulate the kinetics of their expression during early stages of implant integration in vivo, and investigated their effects on the proliferation and osteogenic differentiation of MSCs under PEMF irradiation. The proliferative capacity of MSCs is highly relevant for tissue repair. Cytokines are known to affect proliferation of different cell types. Therefore, we first analyzed the effect of selected cytokines on MSC proliferation. To the best of our knowledge, no previous study had assessed the influence of PEMF irradiation on the production of cytokines in MSC cultures. There are published data on the post-irradiation release of cytokines in mature osteoblasts and in osteoclast-like cells. In both of those studies, ELISA was used for quantification and demonstrated an increase of TNF-a, IL-1b and PG-E2 in relation both to the recruitment of the osteoclast-like cells and to the intensity of the electrical field. The current study demonstrated the ability of MED-generated PEMFs to alter the immuno-modulative activity properties of MSCs. A significant elevation in anti-inflammatory cytokines, such as IL-10, was clearly present when MSCs were seeded on implants. IL-10 acted as an anti-inflammatory substance by inhibiting the synthesis of proinflammatory cytokines, and its up-regulation in MSCs may counteract the detrimental proinflammatory effects.

Second, we examined the effects of PEMFs on the mTOR signaling pathway, and the results confirmed that PEMFs in the presence of an inflammatory environment positively affected MSC commitment into an osteoblastic phenotype through the mTOR pathway. In in vivo model demonstrated that the IGF-1 released from the bone matrix during bone remodeling stimulated osteoblastic differentiation of recruited MSCs by activation of Akt/mTOR. It had been reported that the presence of a good bone-like extracellular matrix was able to maintain bone mass by activation of mTOR in mesenchymal stem cells. We now demonstrated that PEMF irradiation positively stimulated mTOR signaling, thus increasing the osteoblastic commitment of MSCs in the presence of inflammatory stimuli as well. This commitment could also be induced by increased integrin expression, such as ?(4)?(1) integrin that has a high affinity for bone and improves the homing of MSCs to bone, thus promoting osteoblast differentiation and bone formation. mTOR is a central molecule in the regulation of cell growth in a wide variety of cells including osteoblasts, adipocytes, and myocytes. mTOR interacts with several proteins to form two distinct complexes named mTOR complex 1 (mTORC1) and 2 (mTORC2) which differ in their unique components, Raptor and Rictor. Upstream regulation and downstream products of mTORC1 are much more investigated than that of mTORC2. Though it is widely believed that the inhibition of mTOR signaling can promote osteoblastic differentiation, this issue is still controversial. While rapamycin primarily inhibits mTORC1, prolonged exposure can also disrupt mTORC2 function. This fact makes difficult the data interpretation regarding the role played by mTORC1 and mTORC2 in osteogenesis. Martin SK et al. demonstrated that using Cre-mediated gene deletion in well established in-vitro differentiation assays, have shown that mTORC1 and mTORC2 have distinct roles in MSCs fate determination. In agreement with previous studies,, blockade of Raptor in MSCs resultedin reduced adipogenic potential. Under osteoinductive conditions however, Raptor blockade promoted osteogenic differentiation. In current study we demonstrated that in osteogenic medium rapamicin is able to significantely reduce the mineralization of extracellular matrix. However, PEMF treatment is able to abolish this event, ensuring a good mineralization of extracellular environment. In light of these findings, we can assume that in presence of PEMF, the effect of rapamicin on osteoblasts behavior could be the opposit. Gene expression of 84 markers associated with mTOR pathway confirmed that no notable change in gene expression ocurred following rapamicin treatment coadministered with PEMF. While comparing gene expression under rapamicin treatment with PEMF to passive implant, reduction in mTOR2 pathway related genes was found. Namely, we found a reduction in Rictor expression that is associated to an adipogenic commitment of MSCs; and a decrease in several markers associated to a negative regulation of mTOR in both downstream and upstream levels. The most important changes are related to PKC? that, as we have previously demonstrated is strongly related to the adipogenic commitment of MSCs. We showed that PKC? recruits the 66-kD proapoptotic isoform of Shc (p66Shc) to act as oxidoreductase within mitochondria and in triggering a feed-forward cycle of ROS production, eventually leading to cell death. The same players may come together in a radically different context, i.e., the production of cellular signals linking hyperglicemia to the regulation of a transdifferentiation scheme of stem cells residing in adipose tissues. Moreover a downregulation of genes related to adipofunction such as PRKAG3 involved on insulin signalling is well evident. Finally, a significant increase in VEGF gene was demonstrated. These data confirm the ability of PEMF to promote angiogenesis, that is cruicial during tissue regeneration as we have previously demonstrated in wound healing processes,.

The differentiations of MSCs into the osteoblastic or adipogenic lineages are inter-dependent process: molecular components promoting one cell fate inhibit the mechanisms leading the differentiation of the alternative lineage. Interestingly, inducers of differentiation along one lineage often inhibit differentiation along the other. Our results suggest that in presence of osteogenic medium, PEMFs are able to induce osteogenic commitment of MSCs blocking the pathway of adipogenesis via mTOR related proteins.

This study reaults are in a line and comparable with a several previusly published papers. Ardeshirylajimi et al. investigated the the influence of prolonged pulsed extremely low frequency electromagnetic field on the osteogenic potential of cultured induced pluripotent stem cells. They concluded that combination of osteogenic medium and pulsed extremely low frequency electromagnetic field can be a great enhancement for bone differentiation of stem cells and appropriate candidate the management of bone defects and patients suffering from osteoporosis. A recently published paper by Arjmand et al. investigated the osteoinductive potential of PEMF in combination with Poly(caprolactone) (PCL) nanofibrous scaffold. Their results confirmed that the effects of PEMF on the osteogenic differentiation of ADSCs are very similar to these of osteogenic medium. They concluded that due to the immunological concerns regarding the application of bioactive molecules for tissue engineering, PEMF could be a good alternative for osteogenic medium. Additional recent article by Ardeshirylajimi et al. demonstrated that PEMF alone can induce osteogenic differentiation, but this capability was significantly increased when used in combination with electrospun polycaprolactone nanofibers. In addition, simultaneous use of osteogenic medium, PEMF and electrospun nanofibers resulted in increased osteogenic differentiation potential of induced pluripotent stem cells.

This study has several limitations, including its in vitro nature. Furthermore, the cells were grown in a monolayer, which does not accurately reflect in vivo conditions. The primary human cell cultures, however, can serve as a relevant model for examining the effects of PEMFs on bone cell physiology. The modulation of bone cell proliferation markers observed in this study have implications with regard to the immediate effects of PEMFs on bone formation and healing, as well as possible long-term implications for PEMF treatment.

In summary, the findings of the present study revealed that MED-generated PEMFs stimulate osteogenic differentiation and the maturation of the adipose tissue-derived MSCs via activation of the mTOR pathways. We also demonstrated that PEMF exposure increased cell proliferation, adhesion and the osteogenic commitment of MSCs, even in inflammatory conditions. We showed that PEMFs increased the expression of anti-inflammatory cytokines, such as IL-10, and reduced the expression of the pro-inflammatory cytokine IL-1. MSCs provided not only cell sources for connective tissues, but also had a significant influence on the immune response. Further studies are required to investigate the precise mechanisms by which mTOR signaling pathways are influenced and to discover other potential pathways involved in the PEMF-induced osteogenic effects.

Methods

PEMF exposure

The miniaturized electromagnetic device (MED) (Magdent Ltd., Tel Aviv, Israel) was the generator used to stimulate the cells. In the clinical setting, MED technology is used to actively stimulate osteogenesis and osseointegration. The MED was used with a Classix Dental Implant (3.3?mm 10?mm?L Non Touch Prime, Cortex Ltd., Shlomi, Israel). The cells were irradiated continuously for 30 days with the MED inside the incubator and under the same conditions of temperature, humidity and CO2 concentration as non PEMF irradiated cells which served as the controls.

Cell culture

MSCs were extracted from human adipose tissues of 5 healthy women and 5 healthy men (age 21–36 years, body mass index 30–38) who were undergoing cosmetic surgery procedures, following the guidelines of the University of Padova’s Plastic Surgery Clinic. The adipose tissues were digested with 0.075% collagenase (type 1?A; Sigma Aldrich, Italia) in a modified Krebs-Ringer buffer [125?mM NaCl, 5?mM KCl, 1?mM Na3PO4, 1?mM MgSO4, 5.5?mM glucose, and 20?mM HEPES (pH 7.4)] for 60?min at 37?°C, followed by 10?min with 0.25% trypsin. Floating adipocytes were discarded, and cells from the stromal-vascular fraction were pelleted, rinsed with media, and centrifuged, after which a red cell lysis step in NH4Cl was run for 10?min at room temperature. The resulting viable cells were counted using the trypan blue exclusion assay and seeded at a density of 106 cells per cm² for in vitro expansion in Dulbecco’s modified Eagle’s medium (DMEM, SIGMA Aldrich Italia) supplemented with 10% fetal calf serum and 1% penicillin/streptomycin. For treatment in inflammatory conditions, the cells were treated for 24?h with 0.1?mg/mL?1 of tumor necrosis factor-alpha (Celbio). TNF-? concentration used in the study is higher than in physiologic conditions. However, the aforementioned concentration was chosen based on the previously published papers in order to achieve effects in in-vitro studies,.

DNA content

DNA content was determined using a DNeasy kit (Qiagen, Hilden, Germany) to isolate total DNA from cell cultures following the manufacturer’s protocol for tissue isolation, using overnight incubation in proteinase K (Qiagen). DNA concentration was detected by measuring the absorbance at 260?nm in a spectrophotometer. The cell number was then determined from a standard curve (microgram DNA vs. cell number) generated by DNA extraction from the counted cells. The standard curve was linear over the tested range of 5–80?µg DNA (r?=?0.99).

MTT assay

To determine the proliferation rate of cell growth on titanium disks with or without treatment, a methyl thiazolyl-tetrazolium (MTT)-based cytotoxicity assay was performed according to the method of Denizot and Lang with minor modifications. The test is based on mitochondria viability, i.e., only functional mitochondria can oxidize an MTT solution, giving a typical blue-violet endproduct. After harvesting the culture medium, the cells were incubated for 3?h at 37?°C in 1?mL 0.5?mg/mL MTT solution prepared in phosphate buffered saline (PBS) solution. After removal of the MTT solution by pipette, 0.5?mL 10% dimethyl sulfoxide in isopropanol (iDMSO) was added for 30?min at 37?°C. For each sample, absorbance values at 570?nm were recorded in duplicate on 200??L aliquots deposited in 96-well plates using a multilabel plate reader (Victor 3 Perkin Elmer, Milano, Italy). All samples were examined after 15 and 30 days of culture.

RNA extraction and first-strand cDNA synthesis

RNase-Free DNase Set (Qiagen) from implants were cultured with adipose tissue derived mesenchymal stem cells for 15 and 25 days. The RNA quality and concentration of the samples were measured using a NanoDropTM ND-1000 Spectrophotometer (Thermo Scientific). For the first-strand cDNA synthesis, 200?ng of total RNA of each sample was reverse transcribed with M-MLV Reverse Transcriptase (Invitrogen), following the manufacturer’s protocol.

Real-time PCR

Human primers were selected for each target gene with Primer 3 software (Table 1). Real-time PCRs were carried out using the designed primers at a concentration of 300?nM and FastStart SYBR Green Master (Roche) on a Rotor-Gene 3000 (Corbett Research, Sydney, Australia). Real-time PCR was performed also according to the user’s manual for the Human mTOR signaling Profiler PCR Array (SABiosciences, Frederick, MD, USA) and using RT2 SYBR Green ROX FAST Master Mix (Qiagen). The data were analyzed using Excel-based PCR Array Data Analysis Templates (SABiosciences). The thermal cycling conditions were as follows: 15?min denaturation at 95?°C, followed by 40 cycles of 15?s denaturation at 95?°C, annealing for 30?s at 60?°C, and 20?s elongation at 72?°C. Differences in gene expression were evaluated by the 2??Ct method, using MSCs cultured in the presence and absence of inflammatory cytokines and in the presence and absence of PEMFs. Values were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) internal reference whose abundance did not change under our experimental conditions. Experiments were performed with 3 different cell preparations and repeated at least 3 times.

Table 1

List of gene related to mTOR pathway analized by RT PCR.

Description Gene
mTOR1 Complexes: MTOR associated protein, LST8 homolog (S. cerevisiae) MLST8
Mechanistic target of rapamycin (serine/threonine kinase) MTOR
Regulatory associated protein of MTOR, complex 1 RPTOR
mTOR2 Complexes: Mitogen-activated protein kinase associated protein 1 MAPKAP1
RPTOR independent companion of MTOR, complex 2 RICTOR
mTOR Upstream Regulators negative regulation: Eukaryotic translation initiation factor 4E binding protein 1 EIF4EBP1
Eukaryotic translation initiation factor 4E binding protein 2 EIF4EBP2
Protein phosphatase 2, catalytic subunit, alpha isozyme PPP2CA
Protein phosphatase 2, regulatory subunit B, beta PPP2R2B
Protein phosphatase 2?A activator, regulatory subunit 4 PPP2R4
Tumor protein p53 TP53
Unc-51-like kinase 1 (C. elegans) ULK1
Unc-51-like kinase 2 (C. elegans) ULK2
mTOR Upstream Regulators positive regulation: Cell division cycle 42 (GTP binding protein, 25?kDa) CDC42
Conserved helix-loop-helix ubiquitous kinase CHUK
Eukaryotic translation initiation factor 4B EIF4B
Eukaryotic translation initiation factor 4E EIF4E
Glycogen synthase kinase 3 beta GSK3B
Hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) HIF1A
Heat shock 70?kDa protein 4 HSPA4
Integrin-linked kinase ILK
Myosin IC MYO1C
Protein kinase C, alpha PRKCA
Protein kinase C, beta PRKCB
Protein kinase C, epsilon PRKCE
Protein kinase C, gamma PRKCG
Ras homolog gene family, member A RHOA
Ribosomal protein S6 RPS6
Ribosomal protein S6 kinase, 70?kDa, polypeptide 1 RPS6KB1
Ribosomal protein S6 kinase, 70?kDa, polypeptide 2 RPS6KB2
Serum/glucocorticoid regulated kinase 1 SGK1
Vascular endothelial growth factor A VEGFA
Vascular endothelial growth factor B VEGFB
Vascular endothelial growth factor C VEGFC
mTOR Downstream Effectors negative regulation: AKT1 substrate 1 (proline-rich) AKT1S1
Calcium binding protein 39 CAB39
Calcium binding protein 39?L CAB39L
DNA-damage-inducible transcript 4 DDIT4
DNA-damage-inducible transcript 4-like DDIT4L
DEP domain containing MTOR-interacting protein DEPTOR
FK506 binding protein 1?A, 12?kDa FKBP1A
FK506 binding protein 8, 38?kDa FKBP8
Insulin-like growth factor binding protein 3 IGFBP3
Protein kinase, AMP-activated, alpha 1 catalytic subunit PRKAA1
Protein kinase, AMP-activated, alpha 2 catalytic subunit PRKAA2
Protein kinase, AMP-activated, beta 1 non-catalytic subunit PRKAB1
Protein kinase, AMP-activated, beta 2 non-catalytic subunit PRKAB2
Protein kinase, AMP-activated, gamma 1 non-catalytic subunit PRKAG1
Protein kinase, AMP-activated, gamma 2 non-catalytic subunit PRKAG2
Protein kinase, AMP-activated, gamma 3 non-catalytic subunit PRKAG3
Phosphatase and tensin homolog PTEN
Serine/threonine kinase 11 STK11
STE20-related kinase adaptor beta STRADB
Tuberous sclerosis 1 TSC1
Tuberous sclerosis 2 TSC2
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide YWHAQ
mTOR Downstream Effectors positive regulation: V-akt murine thymoma viral oncogene homolog 1 AKT1
V-akt murine thymoma viral oncogene homolog 2 AKT2
V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) AKT3
V-Ha-ras Harvey rat sarcoma viral oncogene homolog HRAS
Insulin-like growth factor 1 (somatomedin C) IGF1
Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta IKBKB
Insulin INS
Insulin receptor INSR
Insulin receptor substrate 1 IRS1
Mitogen-activated protein kinase 1 MAPK1
Mitogen-activated protein kinase 3 MAPK3
3-phosphoinositide dependent protein kinase-1 PDPK1
Phosphoinositide-3-kinase, class 3 PIK3C3
Phosphoinositide-3-kinase, catalytic, alpha polypeptide PIK3CA
Phosphoinositide-3-kinase, catalytic, beta polypeptide PIK3CB
Phosphoinositide-3-kinase, catalytic, delta polypeptide PIK3CD
Phosphoinositide-3-kinase, catalytic, gamma polypeptide PIK3CG
Phospholipase D1, phosphatidylcholine-specific PLD1
Phospholipase D2 PLD2
Ras homolog enriched in brain RHEB
Ribosomal protein S6 kinase, 90?kDa, polypeptide 1 RPS6KA1
Ribosomal protein S6 kinase, 90?kDa, polypeptide 2 RPS6KA2
Ribosomal protein S6 kinase, 90?kDa, polypeptide 5 RPS6KA5
Ras-related GTP binding A RRAGA
Ras-related GTP binding B RRAGB
Ras-related GTP binding C RRAGC
Ras-related GTP binding D RRAGD
TEL2, telomere maintenance 2, homolog (S. cerevisiae) TELO2

Real-time PCR – mTOR

Total RNA was extracted using an RNeasy Lipid Tissue kit (Qiagen), including DNase digestion with the RNase-Free DNase. Set (Qiagen), from the mTOR signalling RT2 profiler PCR Array (gene analized are reported on Table 1). In total, 800?ng of RNA was reverse-transcribed using an RT2 First Strand kit (Qiagen). Real-time PCR was performed according to the user’s manual for the Human mTOR signalling RT2 profiler PCR Array (SABiosciences, Frederick, MD, USA) and using RT2 SYBR Green ROX FAST Master Mix (Qiagen). Thermal cycling and fluorescence detection were performed using a Rotor-Gene Q 100 (Qiagen). The data were analyzed using Excel-based PCR Array Data Analysis Templates (SABiosciences).

Alizarin Red S staining

The extracellular mineral deposits were detected by Alizarin Red S staining. Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich) in PBS for 10?min at room temperature. Cells were stained adding 40?mM freshly Alizarin Red S Solution (pH 4.2) for 10?min at room temperature with gentle shaking. Cells were washed with ddH2O, then photographed by an optical microscope. Alizarin Red S stained area were quantified from microscope images of three independent experiments using ImageJ software (NIH, Bethesda, MD, USA).

ALP activity measurements

Alkaline phosphatase (ALP) activity was measured for up to 20 days of cell culture in order to evaluate the initial differentiation of Adipose Tissue Derived Mesenchymal Stem cells into preosteoblasts. Abcam’s alkaline phosphates kit (colorimetric) was used to detect the intracellular and extracellular ALP activities. The kit uses p-nitrophenyl phosphate (pNPP) as a phosphatase substrate, which is adsorbed at 405?nm when dephosphorylated by ALP. In accordance with the manufacturer’s protocol, the culture medium from each sample group was collected and pooled. At the same time, the cells were washed with PBS and then homogenized with ALP assay buffer (a total of 300??L for each group) and centrifuged at 13,000?rpm for 3?min to remove insoluble material. Different volumes of samples (medium and cells) were then added into 96-well plates, bringing the total volume in each well up to 80??L with assay buffer. In addition, 80??L fresh medium was utilized as sample background control. Thereafter, 50??L 5mMpNPP solution was added to each well containing test samples and background control and incubated for 60?min at 25?°C while shielding the plate from light. A standard curve of 0, 4, 6, 12, 16, and 20?nmol/well was generated from 1?mM pNPP standard solution, bringing the final volume to 120??L with assay buffer. All reactions were then stopped by adding 20??L of stop solution into each standard and sample reaction, except the sample background control reaction. Optical density was read at 405?nm in a microplate reader (Victor). The results were normalized by subtracting the value derived from the zero standards from all standards, samples and sample background control. The pNP standard curve was plotted to identify the pNP concentration in each sample. ALP activity of the test samples was calculated as follows:

ALP activity (U/ml) = A/V/T

where: A is the amount of pNP generated by samples (in ?mol), V is the amount of sample added in the assay well (in mL), and T is the reaction time (in minutes).

Immunofluorescence

Cells were fixed in 4% paraformaldehyde in PBS for 10?min and then incubated in 2% bovine serum albumin (BSA, Sigma-Aldrich) in PBS for 30?min at room temperature. They were then incubated with primary antibodies in 2% BSA solution in a humidified chamber for 12?h at 4?°C. The rabbit polyclonal antihuman phalloidine antibody (Millipore Corporation, MA, USA) was the primary antibody. Immunofluorescence staining was performed using the secondary antibody DyLight 549-labeled anti-rabbit IgG (H?+?L) (KPL, Gaithersburg, MD, USA) diluted 1/1000 in 2% BSA for 1?h at room temperature. Nuclear staining was performed with 2??g/mL Hoechst H33342 (Sigma-Aldrich) solution for 2?min.

Statistical analysis

One-way analysis of variance (ANOVA) was used for data analyses. Levene’s test was used to demonstrate the equal variances of the variables. Repeated measures ANOVA with a post-hoc analysis using Bonferroni’s multiple comparison was performed. T-tests were used to determine significant differences (p?<?0.05). Repeatability was calculated as the standard deviation of the difference between measurements. All testing was performed using SPSS 16.0 software (SPSS Inc., Chicago, IL, USA) (license of the University of Padua, Italy).

Acknowledgements

Research support (including PEMF generting devices and partial support in lab supplies) was provided by Mgdent Ltd.

Author Contributions

B.Z., A.P. and H.A.B. conceived and designed the experiments; L.F., O.D. and C.G. performed the experiments; B.Z., S.B. and C.G. analyzed the data; B.Z. and H.A.B. contributed reagents/materials/analysis tools; B.Z., L.F., M.S. and O.D. wrote the paper.

Notes

Competing Interests

O.D.- payed consultant of the Magdent ltd. Company. S.B.- Co-founder of Magdent ltd.

Footnotes

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

1. Fu YC, et al. A novel single pulsed electromagnetic field stimulates osteogenesis of bone marrow mesenchymal stem cells and bone repair. PLoS One. 2014;9:e91581. doi: 10.1371/journal.pone.0091581.[PMC free article] [PubMed] [Cross Ref]
2. Petecchia L, et al. Electro-magnetic field promotes osteogenic differentiation of BM-hMSCs through a selective action on Ca(2+)-related mechanisms. Sci Rep. 2015;5:13856. doi: 10.1038/srep13856.[PMC free article] [PubMed] [Cross Ref]
3. Song M, et al. The effect of electromagnetic fields on the proliferation and the osteogenic or adipogenic differentiation of mesenchymal stem cells modulated by dexamethasone. Bioelectromagnetics. 2014;35:479–490. doi: 10.1002/bem.21867. [PubMed] [Cross Ref]
4. Yong Y, Ming ZD, Feng L, Chun ZW, Hua W. Electromagnetic fields promote osteogenesis of rat mesenchymal stem cells through the PKA and ERK1/2 pathways. J Tissue Eng Regen Med. 2016;10:E537–E545. doi: 10.1002/term.1864. [PubMed] [Cross Ref]
5. Ongaro A, et al. Pulsed electromagnetic fields stimulate osteogenic differentiation in human bone marrow and adipose tissue derived mesenchymal stem cells. Bioelectromagnetics. 2014;35:426–436. doi: 10.1002/bem.21862. [PubMed] [Cross Ref]
6. Kim MO, Jung H, Kim SC, Park JK, Seo YK. Electromagnetic fields and nanomagnetic particles increase the osteogenic differentiation of human bone marrow-derived mesenchymal stem cells. Int J Mol Med. 2015;35:153–160. doi: 10.3892/ijmm.2014.1978. [PubMed] [Cross Ref]
7. Lin CC, Lin RW, Chang CW, Wang GJ, Lai KA. Single-pulsed electromagnetic field therapy increases osteogenic differentiation through Wnt signaling pathway and sclerostin downregulation. Bioelectromagnetics. 2015;36:494–505. doi: 10.1002/bem.21933. [PubMed] [Cross Ref]
8. Purdue PE, Koulouvaris P, Nestor BJ, Sculco TP. The central role of wear debris in periprosthetic osteolysis. HSS J. 2006;2:102–113. doi: 10.1007/s11420-006-9003-6. [PMC free article] [PubMed][Cross Ref]
9. Anderson JM, Rodriguez A, Chang DT. Foreign body reaction to biomaterials. Semin Immunol. 2008;20:86–100. doi: 10.1016/j.smim.2007.11.004. [PMC free article] [PubMed] [Cross Ref]
10. Branemark R, Branemark PI, Rydevik B, Myers RR. Osseointegration in skeletal reconstruction and rehabilitation: a review. J Rehabil Res Dev. 2001;38:175–181. [PubMed]
11. Trindade R, Albrektsson T, Tengvall P, Wennerberg A. Foreign Body Reaction to Biomaterials: On Mechanisms for Buildup and Breakdown of Osseointegration. Clin Implant Dent Relat Res. 2016;18:192–203. doi: 10.1111/cid.12274. [PubMed] [Cross Ref]
12. Sundfeldt M, Carlsson LV, Johansson CB, Thomsen P, Gretzer C. Aseptic loosening, not only a question of wear: a review of different theories. Acta Orthop. 2006;77:177–197. doi: 10.1080/17453670610045902. [PubMed] [Cross Ref]
13. Glantschnig H, Fisher JE, Wesolowski G, Rodan GA, Reszka AA. M-CSF, TNFalpha and RANK ligand promote osteoclast survival by signaling through mTOR/S6 kinase. Cell Death Differ. 2003;10:1165–1177. doi: 10.1038/sj.cdd.4401285. [PubMed] [Cross Ref]
14. Indo Y, et al. Metabolic regulation of osteoclast differentiation and function. J Bone Miner Res. 2013;28:2392–2399. doi: 10.1002/jbmr.1976. [PubMed] [Cross Ref]
15. Laplante M, Sabatini DM. Regulation of mTORC1 and its impact on gene expression at a glance. J Cell Sci. 2013;126:1713–1719. doi: 10.1242/jcs.125773. [PMC free article] [PubMed] [Cross Ref]
16. Klionsky DJ, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy. 2012;8:445–544. doi: 10.4161/auto.19496. [PMC free article] [PubMed] [Cross Ref]
17. Mizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell. 2011;147:728–741. doi: 10.1016/j.cell.2011.10.026. [PubMed] [Cross Ref]
18. Gharibi B, Farzadi S, Ghuman M, Hughes FJ. Inhibition of Akt/mTOR attenuates age-related changes in mesenchymal stem cells. Stem Cells. 2014;32:2256–2266. doi: 10.1002/stem.1709. [PubMed][Cross Ref]
19. Barak S, et al. A new device for improving dental implants anchorage: a histological and micro-computed tomography study in the rabbit. Clin Oral Implants Res. 2016;27:935–942. doi: 10.1111/clr.12661. [PubMed] [Cross Ref]
20. Ferroni L, et al. Pulsed magnetic therapy increases osteogenic differentiation of mesenchymal stem cells only if they are pre-committed. Life Sci. 2016;152:44–51. doi: 10.1016/j.lfs.2016.03.020. [PubMed][Cross Ref]
21. Deshpande S, et al. Reconciling the effects of inflammatory cytokines on mesenchymal cell osteogenic differentiation. J Surg Res. 2013;185:278–285. doi: 10.1016/j.jss.2013.06.063. [PMC free article][PubMed] [Cross Ref]
22. Li JK, Lin JC, Liu HC, Chang WH. Cytokine release from osteoblasts in response to different intensities of pulsed electromagnetic field stimulation. Electromagn Biol Med. 2007;26:153–165. doi: 10.1080/15368370701572837. [PubMed] [Cross Ref]
23. Chang K, Chang WH, Wu ML, Shih C. Effects of different intensities of extremely low frequency pulsed electromagnetic fields on formation of osteoclast-like cells. Bioelectromagnetics. 2003;24:431–439. doi: 10.1002/bem.10118. [PubMed] [Cross Ref]
24. Xian L, et al. Matrix IGF-1 maintains bone mass by activation of mTOR in mesenchymal stem cells. Nat Med. 2012;18:1095–1101. doi: 10.1038/nm.2793. [PMC free article] [PubMed] [Cross Ref]
25. Sarbassov DD, et al. Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell. 2006;22:159–168. doi: 10.1016/j.molcel.2006.03.029. [PubMed] [Cross Ref]
26. Martin SK, et al. Brief report: the differential roles of mTORC1 and mTORC2 in mesenchymal stem cell differentiation. Stem Cells. 2015;33:1359–1365. doi: 10.1002/stem.1931. [PubMed] [Cross Ref]
27. Xiang X, Zhao J, Xu G, Li Y, Zhang W. mTOR and the differentiation of mesenchymal stem cells. Acta Biochim Biophys Sin (Shanghai) 2011;43:501–510. doi: 10.1093/abbs/gmr041. [PubMed] [Cross Ref]
28. Aguiari P, et al. High glucose induces adipogenic differentiation of muscle-derived stem cells. Proc Natl Acad Sci USA. 2008;105:1226–1231. doi: 10.1073/pnas.0711402105. [PMC free article] [PubMed][Cross Ref]
29. Pavan C, et al. Weight gain related to treatment with atypical antipsychotics is due to activation of PKC-beta. Pharmacogenomics J. 2010;10:408–417. doi: 10.1038/tpj.2009.67. [PubMed] [Cross Ref]
30. Pinton P, Pavan C, Zavan B. PKC-beta activation and pharmacologically induced weight gain during antipsychotic treatment. Pharmacogenomics. 2011;12:453–455. doi: 10.2217/pgs.11.25. [PubMed][Cross Ref]
31. Rimessi A, et al. Protein Kinase C beta: a New Target Therapy to Prevent the Long-Term Atypical Antipsychotic-Induced Weight Gain. Neuropsychopharmacology. 2017;42:1491–1501. doi: 10.1038/npp.2017.20. [PMC free article] [PubMed] [Cross Ref]
32. Ferroni L, et al. Treatment by Therapeutic Magnetic Resonance (TMR) increases fibroblastic activity and keratinocyte differentiation in an in vitro model of 3D artificial skin. J Tissue Eng Regen Med. 2017;11:1332–1342. doi: 10.1002/term.2031. [PubMed] [Cross Ref]
33. Ferroni L, et al. Treatment of diabetic foot ulcers with Therapeutic Magnetic Resonance (TMR(R)) improves the quality of granulation tissue. Eur J Histochem. 2017;61:2800. doi: 10.4081/ejh.2017.2800.[PMC free article] [PubMed] [Cross Ref]
34. Chen Q, et al. Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death Differ. 2016;23:1128–1139. doi: 10.1038/cdd.2015.168. [PMC free article] [PubMed] [Cross Ref]
35. Ardeshirylajimi A, Soleimani M. Enhanced growth and osteogenic differentiation of Induced Pluripotent Stem cells by Extremely Low-Frequency Electromagnetic Field. Cell Mol Biol (Noisy-le-grand) 2015;61:36–41. [PubMed]
36. Arjmand M, Ardeshirylajimi A, Maghsoudi H, Azadian E. Osteogenic differentiation potential of mesenchymal stem cells cultured on nanofibrous scaffold improved in the presence of pulsed electromagnetic field. J Cell Physiol. 2018;233:1061–1070. doi: 10.1002/jcp.25962. [PubMed] [Cross Ref]
37. Ardeshirylajimi A, Khojasteh A. Synergism of Electrospun Nanofibers and Pulsed Electromagnetic Field on Osteogenic Differentiation of Induced Pluripotent Stem Cells. ASAIO J. 2018;64:253–260. doi: 10.1097/MAT.0000000000000631. [PubMed] [Cross Ref]
38. Bonora M, et al. Tumor necrosis factor-alpha impairs oligodendroglial differentiation through a mitochondria-dependent process. Cell Death Differ. 2014;21:1198–1208. doi: 10.1038/cdd.2014.35.[PMC free article] [PubMed] [Cross Ref]
39. Brun P, et al. In vitro response of osteoarthritic chondrocytes and fibroblast-like synoviocytes to a 500-730 kDa hyaluronan amide derivative. J Biomed Mater Res B Appl Biomater. 2012;100:2073–2081. doi: 10.1002/jbm.b.32771. [PubMed] [Cross Ref]
40. Denizot F, Lang R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods. 1986;89:271–277. doi: 10.1016/0022-1759(86)90368-6. [PubMed] [Cross Ref]
Neural Regen Res. 2018 Jan;13(1):145-153. doi: 10.4103/1673-5374.224383.

Low-frequency pulsed electromagnetic field pretreated bone marrow-derived mesenchymal stem cells promote the regeneration of crush-injured rat mental nerve.

Seo N1, Lee SH2, Ju KW2, Woo J3, Kim B4, Kim S5, Jahng JW6, Lee JH7.

Author information

1
Department of Oral and Maxillofacial Surgery, Graduate School of Dentistry, Seoul National University; Dental Research Institute, Seoul National University, Seoul, South Korea.
2
Department of Oral and Maxillofacial Surgery, Seoul National University Dental Hospital; Dental Research Institute, Seoul National University, Seoul, South Korea.
3
Department of Oral and Maxillofacial Surgery, Seoul National University Dental Hospital, Seoul, South Korea.
4
Clinical Translational Research Center for Dental Science (CTRC), Seoul National University Dental Hospital, Seoul, South Korea.
5
Department of Oral and Maxillofacial Surgery, Graduate School of Dentistry, Seoul National University; Department of Oral and Maxillofacial Surgery, Seoul National University Dental Hospital, Seoul, South Korea.
6
Dental Research Institute, Seoul National University, Seoul, South Korea.
7
Department of Oral and Maxillofacial Surgery, Graduate School of Dentistry, Seoul National University; Department of Oral and Maxillofacial Surgery, Seoul National University Dental Hospital; Dental Research Institute, Seoul National University; Clinical Translational Research Center for Dental Science (CTRC), Seoul National University Dental Hospital, Seoul, South Korea.

Abstract

Bone marrow-derived mesenchymal stem cells (BMSCs) have been shown to promote the regeneration of injured peripheral nerves. Pulsed electromagnetic field (PEMF) reportedly promotes the proliferation and neuronal differentiation of BMSCs. Low-frequency PEMF can induce the neuronal differentiation of BMSCs in the absence of nerve growth factors. This study was designed to investigate the effects of low-frequency PEMF pretreatment on the proliferation and function of BMSCs and the effects of low-frequency PEMF pre-treated BMSCs on the regeneration of injured peripheral nerve using in vitro and in vivo experiments. In in vitro experiments, quantitative DNA analysis was performed to determine the proliferation of BMSCs, and reverse transcription-polymerase chain reaction was performed to detect S100 (Schwann cell marker), glial fibrillary acidic protein (astrocyte marker), and brain-derived neurotrophic factor and nerve growth factor (neurotrophic factors) mRNA expression. In the in vivo experiments, rat models of crush-injured mental nerve established using clamp method were randomly injected with low-frequency PEMF pretreated BMSCs, unpretreated BMSCs or PBS at the injury site (1 × 106 cells). DiI-labeled BMSCs injected at the injury site were counted under the fluorescence microscope to determine cell survival. One or two weeks after cell injection, functional recovery of the injured nerve was assessed using the sensory test with von Frey filaments. Two weeks after cell injection, axonal regeneration was evaluated using histomorphometric analysis and retrograde labeling of trigeminal ganglion neurons. In vitro experiment results revealed that low-frequency PEMF pretreated BMSCs proliferated faster and had greater mRNA expression of growth factors than unpretreated BMSCs. In vivo experiment results revealed that compared with injection of unpretreated BMSCs, injection of low-frequency PEMF pretreated BMSCs led to higher myelinated axon count and axon density and more DiI-labeled neurons in the trigeminal ganglia, contributing to rapider functional recovery of injured mental nerve. These findings suggest that low-frequency PEMF pretreatment is a promising approach to enhance the efficacy of cell therapy for peripheral nerve injury repair.

KEYWORDS:

crush-injured mental nerve; low-frequency pulsed electromagnetic field; mesenchymal stem cells; nerve regeneration; peripheral nerve injury

Logo of scirep

About Editorial Board For Authors Scientific Reports
Sci Rep. 2017; 7: 9421.
Published online 2017 Aug 25. doi:  10.1038/s41598-017-09892-w
PMCID: PMC5572790
PMID: 28842627

Enhancement of mesenchymal stem cell chondrogenesis with short-term low intensity pulsed electromagnetic fields

Dinesh Parate,1 Alfredo Franco-Obregón,corresponding author2,3 Jürg Fröhlich,2,4 Christian Beyer,4 Azlina A. Abbas,5 Tunku Kamarul,5James H. P. Hui,corresponding author1,6 and Zheng Yangcorresponding author1,6
1Department of Orthopaedic Surgery, Yong Loo Lin School of Medicine, National University of Singapore, NUHS Tower Block, Level 11, 1E Kent Ridge Road, Singapore, 119288 Singapore
2Department of Surgery, Yong Loo Lin School of Medicine, National University of Singapore, NUHS Tower Block, Level 8, IE Kent Ridge Road, Singapore, 119228 Singapore
3BioIonic Currents Electromagnetic Pulsing Systems Laboratory, BICEPS, National University of Singapore, MD6, 14 medical Drive, #14-01, Singapore, 117599 Singapore
4Institute for Electromagnetic Fields, Swiss Federal Institute of Technology (ETH), Rämistrasse 101, 8092 Zurich, Switzerland
5Tissue Engineering Group (TEG), National Orthopaedic Centre of Excellence for Research and Learning (NOCERAL), Department of Orthopaedic Surgery, Faculty of Medicine, University of Malaya, Pantai Valley, Kuala Lumpur, 50603 Malaysia
6Tissue Engineering Program, Life Sciences Institute, National University of Singapore, DSO (Kent Ridge) Building, #04-01, 27 Medical Drive, Singapore, 117510 Singapore
Alfredo Franco-Obregón, gs.ude.sun@farus.
Contributor Information.
corresponding authorCorresponding author.
Author information ? Article notes ? Copyright and License information ? Disclaimer
Received 2017 Apr 13; Accepted 2017 Jul 28.

Abstract

Pulse electromagnetic fields (PEMFs) have been shown to recruit calcium-signaling cascades common to chondrogenesis. Here we document the effects of specified PEMF parameters over mesenchymal stem cells (MSC) chondrogenic differentiation. MSCs undergoing chondrogenesis are preferentially responsive to an electromagnetic efficacy window defined by field amplitude, duration and frequency of exposure. Contrary to conventional practice of administering prolonged and repetitive exposures to PEMFs, optimal chondrogenic outcome is achieved in response to brief (10?minutes), low intensity (2?mT) exposure to 6?ms bursts of magnetic pulses, at 15?Hz, administered only once at the onset of chondrogenic induction. By contrast, repeated exposures diminished chondrogenic outcome and could be attributed to calcium entry after the initial induction. Transient receptor potential (TRP) channels appear to mediate these aspects of PEMF stimulation, serving as a conduit for extracellular calcium. Preventing calcium entry during the repeated PEMF exposure with the co-administration of EGTA or TRP channel antagonists precluded the inhibition of differentiation. This study highlights the intricacies of calcium homeostasis during early chondrogenesis and the constraints that are placed on PEMF-based therapeutic strategies aimed at promoting MSC chondrogenesis. The demonstrated efficacy of our optimized PEMF regimens has clear clinical implications for future regenerative strategies for cartilage.

Introduction

Articular cartilage is an avascular tissue with low potential for self-repair. When left untreated, lesions of the articular cartilage can lead to osteoarthritis. The success of any technology aimed at repairing chondral defects will thus be based on its ability to produce tissues that most closely recapitulate the mechanical and biochemical properties of native cartilage. To this end many technologies have been advanced yet, none are without drawbacks. The ‘microfracture’ technique is commonly plagued by the formation of fibro-cartilaginous tissue of low dexterity. Autologous chondrocytes implantation and osteochondral autograft transplantation are limited by scarce cartilage production, low proliferative capacity of chondrocytes, chondrocyte de-differentiation and complications due to donor site morbidity. Stem cell-based approaches are also being actively pursued in hopes of improved outcome. Mesenchymal stem cells (MSCs) support chondrogenic differentiation and are an attractive cell source for cartilage tissue engineering. However, the neocartilage formed by conventional MSC-based repair methodologies commonly contain a mixture of fibro- and hyaline cartilage that do not achieve the biochemical, mechanical or functional properties of native cartilage.

MSCs can be differentiated along different cell lineages of mesodermal origin including osteoblasts, chondrocytes, skeletal myocytes or visceral stromal cells. Chondrogenic induction of MSCs entails proliferation, condensation, differentiation and maturation, necessitating endogenous transcriptional and developmental regulators, cell-cell and cell-matrix interactions that, in turn, are modulated by environmental stimuli including mechanical forces, temperature and oxygen levels. A common objective is to recreate as closely as possible the in vivo environmental conditions in vitro so that the rate and quality of chondrogenic development is enhanced and the functionality of the repaired tissue improved. To this end, various environmental stimuli such as hypoxia, mechanical, electric and electromagnetic stimulation are currently being explored.

Mechanical stimulation can be applied in a semi-controlled manner with the use of bioreactors designed to impart shear, compression, tension, or pressure on developing tissues. Appropriately applied mechanical stimulation positively influences MSC-induced chondrogenic differentiation, ECM deposition and the mechanical properties of the generated cartilage. At the cellular level the transduction of mechanical signals (mechanotransduction) involves their conversion into biochemical responses, often with the assistance of mechanosensitive calcium channels. Electromagnetic field (EMF)-stimulation has been shown to promote cell differentiation via the modulation of extracellular calcium entry via plasma membrane-embedded cation channels, raising the intriguing possibility that EMFs may be recruiting related pathways.

Studies examining time-variant or pulsing electromagnetic fields (PEMFs) have alluded to a benefit over articular chondrocytes or cartilaginous tissue in vitro, particularly with reference to chondrocyte proliferation, extracellular matrix (ECM) deposition, secretory activity and inflammatory status. Studies have also examined the effects of PEMF-treatment over the chondrogenic differentiation of stem cells derived from bone marrow, adipose, umbilical cord Wharton jelly, synovial fluid or peripheral blood sources. The reported consequences of PEMF-stimulation over chondrogenesis, however, are largely inconsistent. Some studies report modest enhancements in the gene expression of Sox9, aggrecan, type II collagen (Col 2) as well as deposition of sulfated glycosaminoglycan (sGAG), typically on the order of 2-folds, whereas other studies show little to no effect. On the extreme end of the spectrum, Wang et al. reported inhibition of both Sox9 and Col 2 expression concomitant with induction of hypertrophy and mineralization in response to exposures of 3?h per day at an amplitude of 1?mT. Obvious differences in stimulation protocols likely underlie reported discrepancies. Existing EMF studies have typically employed exposure durations between 30?minutes to 8?h per day and more consistently in the low milli Tesla amplitude range (3–5?mT). Empirical determination of the appropriate exposure and signal parameters for a specific biological response and given tissue are essential as there are indications that cell responses to magnetic fields obey an electromagnetic efficacy window defined by a specific combination of frequency, amplitude and time of exposure that gives rise to optimum cell response. Here, we systematically characterized the effects of PEMF exposure over MSC chondrogenic differentiation by varying the field amplitude, exposure duration and dosage with an emphasis on determining the briefest and lowest amplitude electromagnetic exposure to render a developmental outcome. Given that both mechanical stimuli and calcium entry influences chondrogenic differentiation, we investigated the ability of PEMF exposure to influence calcium homeostasis during early induction of MSCs into the chondrogenic lineage, in particular that attributed to the Transient Receptor Potential (TRP) family of cation-permeable channels, which has been broadly implicated in cellular mechanotransduction. We show that brief and single exposures to low amplitude PEMFs were most effective at stimulating MSC chondrogenesis. Our results also implicate the involvement of calcium influx and the mechanosensitive TRP channels, TRPC1 and TRPV4, in the chondrogenic development stimulated by targeted PEMF exposure.

Results

Effect of PEMF intensities and exposure durations on MSC chondrogenesis

We first sought to determine the magnetic field amplitude and duration of exposure at which MSCs undergoing chondrogenic induction are most responsive using starting conditions preliminarily tested in MSCs for chondrogenic regeneration. MSC pellets in chondrogenic differentiation medium were subjected to single exposures to PEMFs of 10?min duration at intensities ranging in amplitudes between 0–4?mT (Fig. 1A), then subjected to exposure durations between 5 and 60?min at 2?mT intensity (Fig. 1B), applied on the first day of chondrogenic induction. RNA analysis monitoring MSC chondrogenic progression at 7 days post-induction showed greatest increases in response to 10?min exposures applied at an amplitude of 2?mT as evidenced by enhancements in Sox9, aggrecan and Col 2 mRNA expression. By contrast, lower (1?mT) or higher (>3?mT) amplitude of PEMFs (Fig. 1A), or briefer (5?min) or longer (>20?min) durations of exposure (Fig. 1B), resulted in overall smaller effect sizes. The same EMF efficacy window translated to the expression of cartilaginous ECM macromolecular proteins (Fig. 1C). In response to 2?mT amplitude pulsing, a 3-fold increase in Col 2 protein was detected 21 days after chondrogenic induction, whereas no increase was detected with exposure to 3?mT. Moreover, a 2-fold increase in sGAG was detected in response to exposure to 2?mT PEMFs, whereas 3?mT PEMFs produced a significantly smaller increase. The relative ineffectiveness of prolonged exposure to PEMFs was also corroborated at the protein level. Sixty min exposures to 2?mT PEMFs did not elicit significant increases in Col 2 formation than 10?min exposures (Fig. 1C). With reference to sGAG production, PEMF amplitudes greater than 2?mT, or exposure durations of one hour, produced inferior results to 10?min exposures at 2?mT.

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig1_HTML.jpg

Effects of PEMF amplitude (A) and exposure duration (B) on MSC chondrogenesis. Real-time PCR analysis of cartilaginous markers expression after 7 days of differentiation was normalized to GAPDH and presented as fold-changes relative to levels in undifferentiated MSC. (C) Quantification of cartilaginous extracellular matrix macromolecules (Col 2 and sGAG) generated after 21 days of chondrogenic differentiation of MSC subjected to distinct PEMF parameters. All data shown are mean?±?SD, n?=?6 from 2 independent experiments. *Denotes significant increase, or decrease, compared to non-PEMF control. #Denotes significant decrease compared to 2?mT (A), or 10?min (B) PEMF exposure.

Dosage effects of PEMFs over MSC chondrogenesis

We next investigated the effect of repetitive exposures to PEMFs. MSCs were exposed to PEMFs at 2?mT for 10?min/day once, twice or thrice on days 1, 2 and 4 following chondrogenic induction (Fig. 2A). RNA analysis after 7 days of differentiation showed that a single exposure produced the greatest and most consistent increase in the expression of chondrogenic markers (Fig. 2A). In another series of experiments, MSCs pellets were exposed once on the first day of chondrogenic induction, or weekly for 3 consecutive weeks (Fig. 2B). RNA analysis after 21 days of chondrogenic differentiation showed that a single exposure to 2?mT PEMFs for 10?min given on day 1 of induction gave the greatest and most consistent increase in expression of chondrogenic markers relative to no exposure (0?mT) (Fig. 2B). Three weekly exposures either rendered no additional benefit (Col 2) or gave similar results to control (0?mT) (Sox9 and aggrecan). Moreover, the amount of ECM produced was inversely related to the total number of exposures. Single exposures produced >2-folds and ~1-fold increases in Col 2 and sGAG, respectively (Fig. 2C), whereas triple weekly exposures for three weeks (9 total exposures) completely precluded an increase Col 2 and sGAG formation. The change in the amount of DNA across samples varied less than 0.2-fold, although reaching significances at 2?mT, indicating that cell proliferation was only modestly affected within our pellet culture system (Fig. 2C).

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig2_HTML.jpg

Dosage effects of PEMFs over MSC chondrogenesis. (A) MSCs were exposed once (1x), twice (2x) or thrice (3x) per week. (B) MSCs were subjected to either a single exposure on day 1 of chondrogenic induction (1x) or once per week for 3 weeks (3x). Real-time PCR analysis of cartilaginous markers expression at 7 (A) or 21 days (B) after the induction of differentiation was normalized to GAPDH and presented as fold-changes relative to level in undifferentiated MSCs. (C) Quantification of cartilaginous ECM macromolecules generated during chondrogenic differentiation of MSCs in response to distinct PEMF dosing as indicated. MSC pellets were subjected to either a single PEMF exposure given on day 1 of chondrogenic induction (1x) once per week for 3 weeks (3x), or thrice weekly for 3 weeks (9x). Data represents the mean?±?SD, n?=?6 from 2 independent experiments. *Denotes significant increase compare to non-PEMF (0?mT) control. #Denotes significant decrease compared to single PEMF (1x) exposure.

Effect of PEMF treatment to deposition of ECM

ECM deposition in response to PEMF-exposure was also analyzed using Safranin O staining for proteoglycan and immunohistochemical staining for type II collagen (Fig. 3). Stained images of day 21 samples showed an enhanced deposition of proteoglycan and type II collagen in samples exposed only once to 2?mT for 10?min as compared to control (0?mT). By contrast, MSC samples exposed for longer (60?min), to greater amplitude (3?mT) or repeatedly (3x, 9x) yielded comparable, or inferior, ECM deposition to control.

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig3_HTML.jpg

Histological analysis of pellets exposed to PEMFs of distinct amplitude, duration and dosage. Pellets were harvested at day 21, sectioned and subjected to Safranin O or type II collagen immunohistochemistry staining. Images presented were represenation of n?=?3, taken at 100× magnification.

Ca2+ entry pathways implicated in transducing the effects of PEMFs over MSC differentiation

To investigate whether PEMF-stimulated MSC chondrogenesis was depended on calcium influx, EGTA (2?mM) was co-administered to the culture medium during PEMF exposure and summarily replaced afterwards with age-matched chondrogenic control media. RNA analysis at day 7 showed that the inclusion of EGTA significantly decreased the mRNA expression of Sox9, Col 2 and aggrecan in PEMF-treated samples (Fig. 4A), indicating that PEMF-exposure stimulates calcium influx. Conversely, transiently supplementing the differentiation medium with elevated extracellular Ca2+ (5?mM CaCl2) enhanced the mRNA expression of Sox9, Col 2 and aggrecan in otherwise non-exposed samples, and moreover, accentuated chondrogenic gene expression in PEMF-treated samples. These results corroborate that calcium influx is part of the upstream signalling cascade recruited by PEMFs contributing to chondrogenic induction.

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig4_HTML.jpg

Investigation of calcium entry pathways implicated in the PEMF-effect. (A) Involvement of Ca2+ influx in mediating the effects of PEMF-induced MSC chondrogenic differentiation. MSCs were exposed for 10?min at 2?mT alone (control, white bars), or in the presence of 2?mM EGTA (dark grey bars) or 5?mM CaCl2 (hatched bars) transiently added to the culture media. EGTA and CaCl2 were included to the bathing media 10?min before exposure and replaced with age-matched media control cultures 10?min after exposure. (B) Involvement of candidate calcium channels in mediating the effect of PEMs over MSC chondrogenic differentiation. Control MSC chondrogenic differentiation medium (white bars) was supplemented with Nifedipine (1?µM, light grey bars), Ruthenium Red (RR, 10?µM, black bars), or 2-APB (100?µM, dark grey bars) 10?min before exposure and replaced with age-matched media control cultures 10?min after exposure. Real-time PCR analysis was performed on day 7 of differentiation. Data represent the means?±?SD, n?=?6 from 2 independent experiments. *Denotes significant increase, or decrease, compared to non-PEMF (0?mT) control. #Denotes significant decrease relativeto 2?mT PEMF treatment.

To reveal the Ca2+ influx pathway recruited by PEMFs, we pharmacologically dissected the contribution of candidate channels utilizing 2-APB (100?µM) or Ruthenium Red (RR, 10?µM) as TRPC or TRPV cation channel antagonists, respectively, or Nifedipine (1?µM), as a dihydropyridine-sensitive, L-type voltage-gated calcium channel (VGCC) antagonist. Calcium channel antagonists were included into the differentiation medium 10?min before exposure to PEMFs and removed immediately afterwards with age-matched control chondrogenic media. Both 2-APB and Ruthenium Red completely inhibited the PEMF-triggered up-regulation of chondrogenic genes, whereas Nifedipine had no significant inhibitory effect (Fig. 4B). Chondrogenic inhibition by 2-APB and Ruthenium Red was also observed in non-exposed samples, indicating that TRPC- and TRPV-mediated calcium entry are similarly involved in constitutive chondrogenesis upon induction. By contrast, VGCC-mediated Ca2+ entry does not appear to play a predominant role in the early induction of chondrogenesis.

We next investigated the expression profiles of TRP channels (TRPC1, TRPC6, TRPV1, TRPV4, TRPV6) previously implicated in chondrogenesis and correlated these to our PEMF-induced chondrogenic responses. Amongst the panel of candidate TRP channels, the expression of TRPC1 and TRPV4 most closely correlated with our delineated magnetic efficacy window governing chondrogenesis with reference to PEMF amplitude, duration and dosage (Fig. 5 and Suppl. Figures 1 and 2). These results corroborate an involvement of TRPC1 and TRPV4 in the PEMF-induced enhancement of chondrogenic differentiation of MSC we observed.

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig5_HTML.jpg

Expression profiles of TRPC1 and TRPV4 in response to determined PEMF efficacy window regulating MSC chondrogenesis. Real-time PCR analysis of TRPC1 and V4 exposed to different (A) intensities, (B) durations, and (C) dosages of PEMFs. Data represent the means?±?SD, n?=?6 from 2 independent experiments. *Denotes significant increase, or decrease, compared to non-PEMF (0?mT) control. #Denotes significant decrease relative to 2 mT (A), 10?min (B), or single (1x, C) PEMF treatment.

Effect of recurring calcium influx on MSCchondrogenesis

We next investigated whether calcium entry, particularly that via TRPchannels underlies the inhibitory effect observed with repeated PEMF exposures. MSCs were exposed once, twice or thrice to 2?mT PEMFs for 10?min or, alternatively, exposed for 10?min to aged-matched control differentiation media containing elevated extracellular calcium (5?mM CaCl2) in lieu of PEMF exposure. RNA analysis at day 7 showed that MSCs treated once with PEMFs, or transiently administered elevated calcium, on day 1 exhibited enhanced chondrogenesis to comparable levels. By contrast, subsequent exposures to elevated calcium, on days 2 and 4 suppressed chondrogenesis mirrored the effect of multiple exposures to PEMFs (Fig. 6A and Suppl. Fig. 3A).

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig6_HTML.jpg

(A) MSC chondrogenic differentiation in response to multiple exposures to PEMFs or exogenously elevated calcium. MSCs were subjected to either PEMF stimulation alone (white bars) or with transient supplementation of CaCl2 alone (5?mM; hatched bars), once (1x), twice (2x) or thrice (3x) in a week. Dotted lines refers to expression level of non-treated controls. Real-time PCR analysis was performed on day 7 of chondrogenic differentiation. *Denotes significant increase relative to non-PEMF (0?mT) control. # and +denote significant differences relative to respective single (1x) exposure (white and hatched bars, respectively). P?=?PEMF treatment, Ca?=?CaCl2 supplementation. (B) MSC chondrogenic differentiation in response to multiple exposures to PEMFs alone (white bars) or in combination with calcium chelator (EGTA) or TRP channel antagonists. EGTA (2?mM; dark grey bars; “E”), Ruthenium Red (10?µM; RR, black bars; “R”) or 2-APB (100?µM; light grey bars; “C”) was added to the MSC differentiation medium during PEMF expoure applied once (1x), twice (2) or thrice (3x) per week. EGTA, RR and 2-APB were included 10?min before exposure and replaced with media harvested from age-matched chondrogenic control cultures 10?min after exposure. *Denotes significant increase compare to non-PEMF (0?mT) control. #Denotes significant decrease compared to single PEMF exposure (1x). +Denotes significant difference compared to respective PEMF control (white bar). P?=?PEMF treatment, E?=?EGTA, R?=?Ruthenium Red (RR), C?=?2-APB. Data shown are means?±?SD, n?=?6 from 2 independent experiments.

Analogously, precluding calcium entry (with EGTA) also exhibited dichotomous effects if applied during the first versus the second or third exposition to PEMFs, although in opposite direction to that observed with calcium administration or PEMFs. Whereas EGTA added during the initial exposure to PEMFs (1x) prevented PEMF-induced chondrogenesis, EGTA applied during the second or third exposure partially counteracted the inhibition of differentiation exerted by serial PEMF exposure (Fig. 6B and Suppl. Fig. 3B). Notably, impeding calcium entry with transient application of EGTA during both the second and third PEMF exposure was capable of almost completely reversing the inhibition of chondrogenesis observed with repeated PEMF exposures, suggesting that PEMFs are activating disparately functioning calcium mechanisms at early (day 1) and later stages (>day 2) of chondrogenic-induction that confer opposite effects over chondrogenesis. In contrast to the beneficial effect of calcium influx induced by PEMF at the initial stage of chondrogenesis, subsequent induction of calcium influx by repeated pulsing at later stages of chondrogenesis was suppressive of MSC chondrogenesis. The contribution of TRPC- and TRPV-mediated calcium entry to the chondrogenic-inhibition observed with repeated PEMF exposures was investigated by co-administering 2-APB (100?µM) or Ruthenium Red (RR, 10?µM), respectively, during PEMF exposure. As observed with transient EGTA application, antagonism of TRPC1/V4-mediated calcium entry during the first exposition to PEMFs was strongly inhibitory of PEMF-induced chondrogenesis, whereasTRPC1/V4 antagonism during subsequent PEMF expositions was somewhat less protective than EGTA over differentiation (Fig. 6B), implicating other yet to be determined calcium pathways in the later calcium-dependent inhibitory phase of chondrogenic progression. Notably, Ruthenium Red (TRPV4 antagonist) was capable of reverting the inhibition of differentiation and expression of TRPC1 expression in response to repeated PEMFing, whereas 2-APB (TRPC antagonist) was unable to revert the inhibition of differentiation and TRPV4 expression in response to repeated PEMFing, suggesting that TRPV4-mediated calcium entry antagonizes TRPC1 expression leading up to differentiation suppression. The dichotomous effects of precluding calcium entry by EGTA, Ruthenium Red or 2-APB when applied during the first, or the second and third, exposition to PEMFs was corroborated at the protein level. Preventing calcium entry during the initial exposure to PEMFs (1x) prevented PEMF-induced cartilaginous Col 2 and sGAG formation, while blocking calcium entry at later exposures counteracted the inhibition of differentiation exerted by serial PEMF exposure (Fig. 7). Voltage-gated L-type calcium channels, on the other hand, do not appear to be strongly implicated in the response as the expression of its subunits (CACNA1C and CACNA2D1) was not perturbed by PEMF or calcium treatment (Suppl. Fig. 3).

An external file that holds a picture, illustration, etc. Object name is 41598_2017_9892_Fig7_HTML.jpg

Quantification of cartilaginous ECM macromolecules generated by chondrogenically differentiated MSC in response to single or three weekly PEMF exposures alone (white bars) or in combination with calcium chelator (EGTA) or TRP channel antagonists as indicated. EGTA (2?mM; dark grey bars; “E”), Ruthenium Red (10?µM; RR, black bars; “R”) and 2-APB (100?µM; light grey bars; “C”) were included once during single PEMF exposures, or twice during the second and third PEMF exposure. EGTA, RR and 2-APB were added 10?min before exposure and replaced with media harvested from age-matched chondrogenic control cultures 10?min after exposure. *Denotes significant increase compare to non-PEMF (0?mT) control. #Denotes significant decrease compared to single PEMF exposure (1x). +Denotes significant difference compared to respective PEMF control (white bar). P?=?PEMF treatment, E?=?EGTA, R?=?Ruthenium Red (RR), C?=?2-APB. Data represent means?±?SD, n?=?3.

Discussion

Pulsed electromagnetic fields (PEMFs) have been demonstrated to be influential in numerous biological functions including progenitor cell fate determination and differentiation. PEMF-based therapies have been previously shown to enhance chondrocyte and cartilage explant anabolism while also limiting the catabolic consequences of inflammatory cytokines. PEMF exposure has been also reported to enhance the chondrogenic induction of stem cells. Nevertheless, inconsistent and conflicting results plague the scientific literature in this area of study, with PEMF exposures typically being applied on the order of hours per day for several days or weeks at a time. Here we report a high-efficacy of unprecedentedly brief (10?min applied once) PEMF exposure at inducing MSC chondrogenesis. We consistently detected increases in Sox9, Col 2 and aggrecan mRNA (>2-folds) in response to lone exposure to 2?mT PEMFs applied at the commencement of induction for only 10?min (Fig. 1). These increments in mRNA later translated into increased chondrogenic ECM protein formation (>2-fold) after 21 days of differentiation. By contrast, stimulation with greater amplitudes (>3?mT), longer exposures (>20?min) or more frequently (>2x/week) rendered no additional benefit, or was even less effective at promoting chondrogenesis at both the gene and protein levels. Although higher PEMF amplitudes and longer duration exposures were capable of augmenting aggrecan mRNA expression and macromolecular sGAG formation, the levels achieved were no better than those from samples treated only once with 2?mT PEMFs for 10?min. Col 2 expression was especially susceptible to overstimulation, being negatively impacted by exposures >2?mT or longer than 10?minutes. To the best of our knowledge, all published EMF studies examining chondrogenesis have employed exposure durations between 30?min to 8?h. For instance, Mayer-Wagner et al. using PEMF of 15?Hz, 5?mT, exposed MSCs undergoing chondrogenesis for 45?min every 8?h for a total of 21 days and observed less than a 2-fold increase in type II collagen expression, with no detected effect on Sox9 or aggrecan expression. Wang et al. using 1, 2, and 5?mT PEMFs at the frequency of 75?Hz exposed MSCs for 3?h per day for 4 weeks and instead observed a loss of cartilaginous phenotype associated with increased cartilage-specific extracellular matrix degradation in the later stage of chondrogenic differentiation.

Given that most conventional PEMF exposure paradigms employ a multiple exposure strategy and have reported positive chondrogenic outcome, we sought to determine the minimal number of exposures necessary to promote chondrogenesis (Fig. 2). We found that exposing MSCs once at the commencement of chondrogenic differentiation (1x) was necessary and sufficient to induce chondrogenic gene expression (Fig. 2A), which was sustainable for up to 21 days post chondrogenic-induction (Fig. 2B). The superior effect of a single pulse was also confirmed at the level of sGAG and Col 2 protein deposition (Figs 2C and ?and3).3). Indeed, in response to 3 exposures per week (10?min pulsing) for 3 consecutive weeks (9x treatments), ECM deposition was unchanged, or even inhibited, relative to unexposed samples. Ours is likely the first report to demonstrate an effectiveness of lone, 10?min, low amplitude PEMF exposures over MSC chondrogenesis, while concomitantly demonstrating the counter productivity of prolonged or repeated exposures. The possibility that prolonged or repeated PEMF exposures were merely cytotoxic, rather than truly inhibitory to chondrogenesis, was ruled out by our finding that total DNA content across all treatments was largely unchanged, despite lower Col 2 yield. In addition, the amount of sGAG was either unchanged or higher than that in control non-pulsed samples, further indicating that prolonged/repeated PEMF exposure did not adversely influence cell viability. Finally, the PEMF paradigm demonstrated here to best promote chondrogenesis (2?mT applied once for 10?min) did not alter the expression of osteogenic genes, Runx2 and ALP (Suppl. Fig. 4). Provocatively, osteogenic markers did increase following 20?min exposure to 2?mT PEMFs, thereby substantiating our assertion that reduced chondrogenic expression is not a reflection of cell death, but likely deferred chondrogenesis towards osteogenesis. Our demonstration of the high efficacy of brief and early PEMF exposure might thus help explain the existing inconsistencies and the relatively weaker responses previously reported.

Chondrogenesis is known to be modulated by calcium signaling cascades of specific temporal sensitivity,. The dependence of chondrogenesis on extracellular Ca2+ was first alluded to with the demonstration that elevated extracellular Ca2+ promoted chondrogenic differentiation in chick limb bud-derived cultures. Moreover, Sox9, the master transcription factor of chondrogenesis, is subject to Ca2+-calmodulin regulation. Elevation in cytoplasmic calcium downstream of calcium influx has been demonstrated in response to electric field (EF) or EMF stimulation during MSC-derived osteogenesis or chondrogenesis. We show that MSC chondrogenesis depends on the presence of extracellular Ca2+, whereby a transient (10?min) elevation of extracellular Ca2+ or brief (10?min) exposure to PEMFs (Figs 4Aand ?and6A)6A) enhanced MSC chondrogenic differentiation in an additive manner. Previous studies have also revealed that chondrogenesis is positively responsive to intracellular Ca2+ within a tightly controlled concentration window. A 1.25-fold increase in cytosolic Ca2+ concentration was shown to promote differentiation, whereas a moderately greater increase (1.5-fold) negatively influenced in vitrochondrogenesis. It is thus feasible that high amplitude or prolonged PEMF exposures elevate cytoplasmic calcium levels beyond the beneficial threshold for MSC chondrogenic differentiation. It is also well documented that the spatial and temporal patterns of intracellular free Ca2+ concentration play important roles in the regulation of various cellular processes, governed not only by absolute Ca2+ level, but also by periodic oscillatory changes of cytosolic Ca2+ concentration. MSCs undergoing chondrogenesis increase their frequency of Ca2+oscillations (waves) in the early stages of differentiation, coinciding with the initial period of cellular condensation during the first 2–4 days. Conversely, sustained elevations of extracellular calcium inhibit chondrogenesis, demonstrating a temporal requirement for calcium. Here we show that transient pulsing with elevated calcium recapitulates the temporal characteristic of the inhibitory actions of repeated PEMF exposures (Fig. 6A). Moreover, preventing calcium entry (with EGTA) during repeated PEMF exposure precludes the inhibition (Figs 6B and ?and7),7), defining a developmental change in calcium-sensitivity following calcium-dependent initiation of chondrogenesis. In this respect, single brief exposition to PEMFs defined by a specified electromagnetic window applied during the early stages of MSC chondrogenesis may be sufficient to provide the correct catalytic rise in intracellular Ca2+ to optimally promote the initiation of chondrogenesis. Conversely, higher exposure intensities or multiple exposures could result in excessive or sustained calcium influx that may instead disrupts or interrupts MSC-induced chondrogenesis, respectively.

Ca2+ influx via membrane-associated cation channels is a key event in initiating chondrogenesis, that can be potentially mediated by either TRP channels and/or voltage-gated calcium channels (VGCC). The transient receptor potential (TRP) channels are a diverse and widely distributed family of cation channel broadly implicated in cellular mechanotransduction. The TRPC and TRPV subfamilies have been broadly implicated in calcium homeostasis, ascribed mechanically-mediated gating, as well as implicated in the developmental programs of diverse mechanosensitive tissues. Previous studies have shown that blocking TRPV4 during the initial stages of induction inhibited chondrogenesis,. TRPV4-mediated Ca2+ signaling is also a positive regulator of Sox9 and as such, has been shown to promote chondrogenesis and in transducing the mechanical signals that support cartilage extracellular matrix maintenance and joint health. TRPC1 is expressed during early chondrocyte expansion, as well as being involved in the proliferation of mesenchymal stem cells. We detected time, intensity, and PEMF dosage-dependent up-regulations of both TRPV4 and TRPC1 that closely correlated with the PEMF-induced expression pattern of chondrogenic markers (Fig. 5). Blocking TRPC1 and TRPV4 channels with 2-APB and Ruthenium Red, respectively, in the early stage of differentiation effectively inhibited chondrogenesis, implicating these TRP channels in the initiation of chondrogenesis, and indicating that PEMFs recruit the activity of these channels to enhance chondrogenesis. Notably, blocking calcium-permeation through TRPV4 channels reverses the inhibition on chondrogenic differentiation and TRPC1 expression during repeated PEMF exposure, whereas blocking TRPC1 channels was unable to revert the inhibition on differentiation and expression of TRPV4 in response to repeated PEMF exposure, suggesting that TRPV4-mediated calcium entry antagonizes TRPC1 expression and is an essential step in initiating differentiation (Figs 6B and ?and7).7). TRPV4-mediated calcium entry may thus increase after the induction of differentiation (>2 days) serving to curtail TRPC1 expression and thereby promote differentiation by inhibiting TRPC1-medited proliferation (Suppl. Fig. 2).

An involvement of voltage-gated calcium channels was more difficult to establish. A predominant role for L-type VGCCs (CACNA1, CACNA2D1) in transducing PEMF’s effects was not supported given that a chondrogenically-effective dose of, Nifedipine, a L-type VGCC antagonist, had no significant effect on the PEMF-induced upregulation of MSC chondrogenesis (Fig. 4B). Moreover, the expression level of the L-type channel was not correlated with changes in calcium (Suppl. Fig. 3). Ca2+ influx via the low-threshold T-type VGCC had been previously implicated in tracheal chondrogenesis. The expression of T-type VGCC (CACNA1H) was induced by lone early exposure to PEMFs or transient calcium administration, and was suppressed by repeated exposures to PEMF or extracellular calcium, mirroring the expression pattern of chondrogenic markers under identical conditions (Suppl. Fig. 3A). The induction of the T-type calcium channel in response to PEMF/calcium exposure more likely reflects chondrogenic differentiation, rather than a fully determinant role in PEMF-induced chondrogenesis, as its expression was in the majority of conditions unchanged (relative to control) by removal of extracellular calcium during PEMF exposure (Suppl. Fig. 3B). Our strongest data support the interpretation that TRPC1 and TRPV4 play a more predominant role, although not necessarily exclusive, in transducing the chondrogenic effects of PEMFs. Further work will require to fully disentangle the intricasy of calcium homeostasis during the chondrogenic developmental process.

In summary, we have provided comprehensive characterization of the effects of PEMFs over MSC chondrogenic differentiation. MSCs undergoing chondrogenic induction are preferentially responsive to a well-defined window of PEMF stimulation of particular amplitude (2?mT), duration (10?min) and dosage (once on day 1 induction). By contrast, treatment with higher amplitude PEMFs, longer exposure durations or repeated expositions, as are more common in the field, are generally counterproductive, helping explain the lack of resolution in the field. Our results indicate that PEMFs mediate their effect by activating calcium influx through mechanosensitive calcium TRP channels. The unprecedented efficacy of our low amplitude, exceptionally brief and non-invasive PEMF-exposure protocol over MSC chondrogenesis has broad clinical and practical implications for the ultimate translation of related PEMF-based therapeutic strategies for stem cell-based cartilage regeneration.

Methods

Human bone marrow MSCs culture and chondrogenic differentiation

Primary human mesenchymal stem cells (MSCs) were purchased from RoosterBio Inc. (Frederick, MD), supplied at passage 3. The MSCs was further expanded in MSC High Performance Media (RoosterBio Inc.) at 37?°C in 5% CO2 atmosphere. The expanded MSCs were used at passage 5–6. Chondrogenic differentiation of MSCs was induced through 3D pellet culture as previously described. Briefly, 2.5?×?105 cells were centrifuged to form pellets and cultured in a chondrogenic differentiation medium containing high glucose DMEM supplemented with 4?mM proline, 50?µg/mL ascorbic acid, 1% ITS-Premix (Becton-Dickinson, San Jose, CA), 1?mM sodium pyruvate, and 10?7?M dexamethasone (Sigma-Aldrich, St Louis, MO), in the absence of antibiotics, for up to 7 or 21 days in the presence of 10 ng/mL of transforming growth factor-?3 (TGF?3; R&D Systems, Minneapolis, MN). To investigate an involvement of calcium influx or of calcium channels in transmitting the effects of PEMFs, cells were pre-incubated in chondrogenic media supplemented with elevated calcium, EGTA or particular calcium channel antagonist for 10?minutes prior to pulsing. Ten minutes after exposure to PEMFs the supplemented chondrogenic media was replaced with age-matched chondrogenic media (0?mT) cultures. To attenuate extracellular calcium influx, 2?mM ethylene-bis(oxyethylenenitrilo) tetraacetic acid (EGTA; Sigma) was added to the bathing media as noted. To promote extracellular Ca2+ influx the bathing media was supplemented with 5?mM CaCl2 (Sigma). To block calcium permeation through dihydropyridine-sensitive, L-type voltage-gated calcium channel (VGCC), Nifedipine (1?µM, Sigma) was added to the bathing media. 2-aminoethoxydiphenyl borate (2-APB, 100?µM, Sigma) and Ruthenium Red (10?µM, Merck Millipore) were administered as indicated to block calcium entry via TRPC and TRPV channels, respectively. Aminoglycoside antibiotics such as streptomycin were excluded in all MSC expansion and chondrogenic differentiation media to avoid interference with mechanosensitive ion channels.

PEMF Exposure system

The ELF-PEMF (extremely low frequency – pulsed magnetic field) delivery system has been described previously. For the purposes of this study a barrage of magnetic pulses of 6 ms duration was applied at a repetition rate of 15?Hz and at flux densities between 1–4?mT. Each 6 ms burst consisted of a series of 20 consecutive asymmetric pulses of 150?µs on and off duration with an approximate rise time of 17?T/s. The background magnetic flux density measured in the chamber was below 1?µT between 0?Hz to 5?kHz. The coil size, position and individual number of windings were numerically optimized by a CST low frequency solver for low field non-uniformity over a wide frequency range taking into consideration the shielding capacity of the µ-metallic chassis. The measured field non-uniformity did not exceed 4% within the uniform exposure region of the coils.

PEMF treatment

To investigate the optimum dosage of PEMF, MSCs in a 3D pellet culture were exposed to PEMFs of different exposure durations, dosage and the magnetic flux amplitude. MSCs were subjected to PEMFs of 1–4?mT amplitude with exposure times ranging between 5 to 60?min on the day of chondrogenic induction, applied once or multiple times as indicated in the respective figure legend. Cell pellets to be treated once with PEMFs (1x) were exposed on first day of chondrogenic induction. Two scenarios of multiple exposures were administrated (Fig. 2). Firstly, multiple exposures were administrated during the course of a week; double exposures (2x) were applied on days 1 and 2; triple exposures (3x) on days 1, 2 and 4. Alternatively, multiple exposures were applied on a once a week basis, for up to three week. Non-exposed (control) cells were placed within the PEMF device without current flux to produce a magnetic field to ensure that all cells were subject to the same climatic and mechanical conditions.

Real time PCR analysis

Chondrogenic cell pellets were digested in 0.25% Type II collagenase (Gibco, Life Technologies) followed by centrifugation. Total RNA was extracted using the RNeasy® Mini Kit (Qiagen, Germany). Reverse transcription was performed with 100 ng total RNA using iScript™ cDNA synthesis kit (Bio-Rad, USA). Real-time PCR was conducted using the SYBR®green assay on ABI 7500 Real-Time PCR System (Applied Biosystems, Life Technologies, USA). Real-time PCR program was set at 95?°C for 10?min, followed by 40 cycles of amplifications, consisting of a 15?s denaturation at 95?°C and a 1?min extension step at 60?°C. Primer sequences used in this study were according to previous publication and presented as Supplementary Table 1. The level of expression of the target gene, normalized to GAPDH, was then calculated using the 2???Ct formula with reference to the undifferentiated MSC. Results were averaged from triplicate samples of two independent experiments.

ECM and DNA quantification

Samples harvested were digested with 10?mg/mL of pepsin in 0.05?M acetic acid at 4?°C, followed by digestion with elastase (1?mg/mL). A Blyscan sulfated glycosaminoglycan (sGAG) assay kit (Biocolor Ltd., Newtownabbey, Ireland) was used to quantify sGAG deposition according to manufacturer’s protocol. Absorbance was measured at 656?nm and sGAG concentration was extrapolated from a standard curve generated using a sGAG standard. Type II Collagen (Col 2) content was measured using a captured enzyme-linked immunosorbent assay (Chondrex, Redmond, WA). Absorbance at 490?nm was measured and the concentration of Col 2 was extrapolated from a standard curve generated using a Col 2 standard. Values for sGAG and Col 2 content obtained were normalized to the total DNA content of respective samples, measured using Picogreen dsDNA assay (Molecular Probes, OR, USA). Quadruplicates of each group were analyzed from two independent experiments.

Histological and immunohistochemical evaluation

Samples were fixed in formalin, dehydrated, paraffin embedded, and cut into sections of 5?µm. For Safranin-O staining, the sections were incubated in hematoxylin (Sigma-Aldrich), washed and stained with fast green (Sigma-Aldrich), before staining with Safranin-O solution (AcrosOrganics). For immunohistochemistry, ultra-vision detection kit (Thermo scientific) was used. Endogenous peroxidase in the sections was first blocked with hydrogen peroxide before pepsin treatment for 20?min. Samples were treated with monoclonal antibodies of collagen type II (Clone 6B3; Chemicon Inc.) followed by incubation with biotinylated goat anti-mouse (Lab Vision Corporation). A mouse IgG isotype (Zymed Laboratories Inc.) was used as control for immunohistochemistry studies.

Statistical analysis

All experiments were performed in biological replicates (n?=?3 or 4) and results reported as mean?±?standard deviation (SD). Statistical analysis was carried out by Students t-test for comparison between two groups using the Microsoft Excel software. The level of significance was set at p?<?0.05. All quantitative data reported here were averaged from at least two independent experiments.

 

Electronic supplementary material

Acknowledgements

The study was supported by University of Malaya HIR-MoE Grant (Reference number – UM.C/625/1/HIR/MOHE/MED/32 account number – H20001-E000071) and Singapore-MIT Alliance for Research and Technology (SMART) Foundation (ING14085-BIO). Dinesh Parate was supported by NUS Research scholarship.

Author Contributions

D.P. performed experiments, analyzed data and drafted the manuscript. A.F.O., J.F. and C.B. provided technological expertise and contributed to the fabrication the PEMF facility. A.A.A., T.K., J.H.P.H. and A.F.O. provided funding and critical reading of the manuscript. A.F.O. and Z.Y. designed the study, analyzed data and provided critical revision of the manuscript. All authors reviewed the manuscript.

Notes

Competing Interests

The authors declare that they have no competing interests.

Footnotes

Electronic supplementary material

Supplementary information accompanies this paper at doi:10.1038/s41598-017-09892-w

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Alfredo Franco-Obregón, gs.ude.sun@farus.

James H. P. Hui, gs.ude.shun@iuh_semaj.

Zheng Yang, gs.ude.sun@zyisl.

References

1. Poole, A. R. et al. Composition and structure of articular cartilage: a template for tissue repair. Clin Orthop Relat Res S26–33 (2001). [PubMed]
2. Goldring MB, Goldring SR. Osteoarthritis. J Cell Physiol. 2007;213:626–34. doi: 10.1002/jcp.21258.[PubMed] [Cross Ref]
3. Ge Z, et al. Osteoarthritis and therapy. Arthritis Rheum. 2006;55:493–500. doi: 10.1002/art.21994.[PubMed] [Cross Ref]
4. Buckwalter JA, Mankin HJ. Articular cartilage: degeneration and osteoarthritis, repair, regeneration, and transplantation. Instr Course Lect. 1998;47:487–504. [PubMed]
5. Vasara, A.I. et al. Indentation stiffness of repair tissue after autologous chondrocyte transplantation. Clin Orthop Relat Res, 233–42 (2005). [PubMed]
6. Wakitani S, et al. Mesenchymal cell-based repair of large, full-thickness defects of articular cartilage. J Bone Joint Surg Am. 1994;76:579–92. doi: 10.2106/00004623-199404000-00013. [PubMed] [Cross Ref]
7. Wakitani S, et al. Human autologous culture expanded bone marrow mesenchymal cell transplantation for repair of cartilage defects in osteoarthritic knees. Osteoarthritis Cartilage. 2002;10:199–206. doi: 10.1053/joca.2001.0504. [PubMed] [Cross Ref]
8. Kuroda R, et al. Treatment of a full-thickness articular cartilage defect in the femoral condyle of an athlete with autologous bone-marrow stromal cells. Osteoarthritis Cartilage. 2007;15:226–31. doi: 10.1016/j.joca.2006.08.008. [PubMed] [Cross Ref]
9. Pittenger MF, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143–7. doi: 10.1126/science.284.5411.143. [PubMed] [Cross Ref]
10. Goldring MB, Tsuchimochi K, Ijiri K. The control of chondrogenesis. J Cell Biochem. 2006;97:33–44. doi: 10.1002/jcb.20652. [PubMed] [Cross Ref]
11. Mahmoudifar N, Doran PM. Chondrogenesis and cartilage tissue engineering: the longer road to technology development. Trends Biotechnol. 2012;30:166–76. doi: 10.1016/j.tibtech.2011.09.002.[PubMed] [Cross Ref]
12. Woods A, Wang G, Beier F. Regulation of chondrocyte differentiation by the actin cytoskeleton and adhesive interactions. J Cell Physiol. 2007;213:1–8. doi: 10.1002/jcp.21110. [PubMed] [Cross Ref]
13. DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cartilage development. Osteoarthritis Cartilage. 2000;8:309–34. doi: 10.1053/joca.1999.0306. [PubMed] [Cross Ref]
14. Toh WS, Spector M, Lee EH, Cao T. Biomaterial-mediated delivery of microenvironmental cues for repair and regeneration of articular cartilage. Mol Pharm. 2011;8:994–1001. doi: 10.1021/mp100437a.[PubMed] [Cross Ref]
15. Klein TJ, Malda J, Sah RL, Hutmacher DW. Tissue engineering of articular cartilage with biomimetic zones. Tissue Eng Part B Rev. 2009;15:143–57. doi: 10.1089/ten.teb.2008.0563. [PMC free article][PubMed] [Cross Ref]
16. Raghothaman D, et al. Engineering cell matrix interactions in assembled polyelectrolyte fiber hydrogels for mesenchymal stem cell chondrogenesis. Biomaterials. 2014;35:2607–16. doi: 10.1016/j.biomaterials.2013.12.008. [PubMed] [Cross Ref]
17. Responte DJ, Lee JK, Hu JC, Athanasiou KA. Biomechanics-driven chondrogenesis: from embryo to adult. FASEB J. 2012;26:3614–24. doi: 10.1096/fj.12-207241. [PMC free article] [PubMed] [Cross Ref]
18. Mouw JK, Connelly JT, Wilson CG, Michael KE, Levenston ME. Dynamic compression regulates the expression and synthesis of chondrocyte-specific matrix molecules in bone marrow stromal cells. Stem Cells. 2007;25:655–63. doi: 10.1634/stemcells.2006-0435. [PubMed] [Cross Ref]
19. Grad S, Eglin D, Alini M, Stoddart MJ. Physical stimulation of chondrogenic cells in vitro: a review. Clin Orthop Relat Res. 2011;469:2764–72. doi: 10.1007/s11999-011-1819-9. [PMC free article] [PubMed][Cross Ref]
20. Cheing GL, Li X, Huang L, Kwan RL, Cheung KK. Pulsed electromagnetic fields (PEMF) promote early wound healing and myofibroblast proliferation in diabetic rats. Bioelectromagnetics. 2014;35:161–9. doi: 10.1002/bem.21832. [PubMed] [Cross Ref]
21. Steward AJ, Kelly DJ, Wagner DR. The role of calcium signalling in the chondrogenic response of mesenchymal stem cells to hydrostatic pressure. Eur Cell Mater. 2014;28:358–71. doi: 10.22203/eCM.v028a25. [PubMed] [Cross Ref]
22. Pingguan-Murphy B, El-Azzeh M, Bader DL, Knight MM. Cyclic compression of chondrocytes modulates a purinergic calcium signalling pathway in a strain rate- and frequency-dependent manner. J Cell Physiol. 2006;209:389–97. doi: 10.1002/jcp.20747. [PubMed] [Cross Ref]
23. Eijkelkamp N, Quick K, Wood JN. Transient receptor potential channels and mechanosensation. Annu Rev Neurosci. 2013;36:519–46. doi: 10.1146/annurev-neuro-062012-170412. [PubMed] [Cross Ref]
24. Matta C, Zakany R. Calcium signalling in chondrogenesis: implications for cartilage repair. Front Biosci (Schol Ed) 2013;5:305–24. doi: 10.2741/S374. [PubMed] [Cross Ref]
25. Pall ML. Electromagnetic fields act via activation of voltage-gated calcium channels to produce beneficial or adverse effects. J Cell Mol Med. 2013;17:958–65. doi: 10.1111/jcmm.12088.[PMC free article] [PubMed] [Cross Ref]
26. Ross CL, et al. The effect of low-frequency electromagnetic field on human bone marrow stem/progenitor cell differentiation. Stem Cell Res. 2015;15:96–108. doi: 10.1016/j.scr.2015.04.009.[PMC free article] [PubMed] [Cross Ref]
27. Petecchia L, et al. Electro-magnetic field promotes osteogenic differentiation of BM-hMSCs through a selective action on Ca(2+)-related mechanisms. Sci Rep. 2015;5 doi: 10.1038/srep13856.[PMC free article] [PubMed] [Cross Ref]
28. Schmidt-Rohlfing B, Silny J, Woodruff S, Gavenis K. Effects of pulsed and sinusoid electromagnetic fields on human chondrocytes cultivated in a collagen matrix. Rheumatol Int. 2008;28:971–7. doi: 10.1007/s00296-008-0565-0. [PubMed] [Cross Ref]
29. Vincenzi F, et al. Pulsed electromagnetic fields increased the anti-inflammatory effect of A(2)A and A(3) adenosine receptors in human T/C-28a2 chondrocytes and hFOB 1.19 osteoblasts. PLoS One. 2013;8doi: 10.1371/journal.pone.0065561. [PMC free article] [PubMed] [Cross Ref]
30. De Mattei M, et al. Effects of pulsed electromagnetic fields on human articular chondrocyte proliferation. Connect Tissue Res. 2001;42:269–79. doi: 10.3109/03008200109016841. [PubMed][Cross Ref]
31. Sakai A, Suzuki K, Nakamura T, Norimura T, Tsuchiya T. Effects of pulsing electromagnetic fields on cultured cartilage cells. Int Orthop. 1991;15:341–6. doi: 10.1007/BF00186874. [PubMed] [Cross Ref]
32. Hilz FM, et al. Influence of extremely low frequency, low energy electromagnetic fields and combined mechanical stimulation on chondrocytes in 3-D constructs for cartilage tissue engineering. Bioelectromagnetics. 2014;35:116–28. doi: 10.1002/bem.21822. [PubMed] [Cross Ref]
33. Boopalan PR, Arumugam S, Livingston A, Mohanty M, Chittaranjan S. Pulsed electromagnetic field therapy results in healing of full thickness articular cartilage defect. Int Orthop. 2011;35:143–8. doi: 10.1007/s00264-010-0994-8. [PMC free article] [PubMed] [Cross Ref]
34. Mueller MB, Tuan RS. Functional characterization of hypertrophy in chondrogenesis of human mesenchymal stem cells. Arthritis Rheum. 2008;58:1377–88. doi: 10.1002/art.23370. [PMC free article][PubMed] [Cross Ref]
35. Chen CH, et al. Electromagnetic fields enhance chondrogenesis of human adipose-derived stem cells in a chondrogenic microenvironment in vitroJ Appl Physiol (1985) 2013;114:647–55. doi: 10.1152/japplphysiol.01216.2012. [PubMed] [Cross Ref]
36. Lim, H. L. et al. Dynamic Electromechanical Hydrogel Matrices for Stem Cell Culture. Adv Funct Mater21 (2011). [PMC free article] [PubMed]
37. Wang J, et al. Pulsed electromagnetic field may accelerate in vitro endochondral ossification. Bioelectromagnetics. 2015;36:35–44. doi: 10.1002/bem.21882. [PubMed] [Cross Ref]
38. Mayer-Wagner S, et al. Effects of low frequency electromagnetic fields on the chondrogenic differentiation of human mesenchymal stem cells. Bioelectromagnetics. 2011;32:283–90. doi: 10.1002/bem.20633. [PubMed] [Cross Ref]
39. Esposito M, et al. Differentiation of human umbilical cord-derived mesenchymal stem cells, WJ-MSCs, into chondrogenic cells in the presence of pulsed electromagnetic fields. In Vivo. 2013;27:495–500.[PubMed]
40. Ongaro A, et al. Electromagnetic fields counteract IL-1beta activity during chondrogenesis of bovine mesenchymal stem cells. J Tissue Eng Regen Med. 2015;9:E229–38. doi: 10.1002/term.1671. [PubMed][Cross Ref]
41. Spaas JH, et al. Chondrogenic Priming at Reduced Cell Density Enhances Cartilage Adhesion of Equine Allogeneic MSCs – a Loading Sensitive Phenomenon in an Organ Culture Study with 180 Explants. Cell Physiol Biochem. 2015;37:651–65. doi: 10.1159/000430384. [PubMed] [Cross Ref]
42. Berg H. Problems of weak electromagnetic field effects in cell biology. Bioelectrochem Bioenerg. 1999;48:355–60. doi: 10.1016/S0302-4598(99)00012-4. [PubMed] [Cross Ref]
43. Crocetti S, et al. Low intensity and frequency pulsed electromagnetic fields selectively impair breast cancer cell viability. PLoS One. 2013;8 doi: 10.1371/journal.pone.0072944. [PMC free article] [PubMed][Cross Ref]
44. O’Conor CJ, Case N, Guilak F. Mechanical regulation of chondrogenesis. Stem Cell Res Ther. 2013;4doi: 10.1186/scrt211. [PMC free article] [PubMed] [Cross Ref]
45. Sun LY, et al. Effect of pulsed electromagnetic field on the proliferation and differentiation potential of human bone marrow mesenchymal stem cells. Bioelectromagnetics. 2009;30:251–60. doi: 10.1002/bem.20472. [PubMed] [Cross Ref]
46. Fodor J, et al. Store-operated calcium entry and calcium influx via voltage-operated calcium channels regulate intracellular calcium oscillations in chondrogenic cells. Cell Calcium. 2013;54:1–16. doi: 10.1016/j.ceca.2013.03.003. [PubMed] [Cross Ref]
47. San Antonio JD, Tuan RS. Chondrogenesis of limb bud mesenchyme in vitro: stimulation by cations. Dev Biol. 1986;115:313–24. doi: 10.1016/0012-1606(86)90252-6. [PubMed] [Cross Ref]
48. Matta C, et al. Cytosolic free Ca2+ concentration exhibits a characteristic temporal pattern during in vitro cartilage differentiation: a possible regulatory role of calcineurin in Ca-signalling of chondrogenic cells. Cell Calcium. 2008;44:310–23. doi: 10.1016/j.ceca.2007.12.010. [PubMed] [Cross Ref]
49. Argentaro A, et al. A SOX9 defect of calmodulin-dependent nuclear import in campomelic dysplasia/autosomal sex reversal. J Biol Chem. 2003;278:33839–47. doi: 10.1074/jbc.M302078200.[PubMed] [Cross Ref]
50. McCullen SD, et al. Application of low-frequency alternating current electric fields via interdigitated electrodes: effects on cellular viability, cytoplasmic calcium, and osteogenic differentiation of human adipose-derived stem cells. Tissue Eng Part C Methods. 2010;16:1377–86. doi: 10.1089/ten.tec.2009.0751.[PMC free article] [PubMed] [Cross Ref]
51. Xu J, Wang W, Clark CC, Brighton CT. Signal transduction in electrically stimulated articular chondrocytes involves translocation of extracellular calcium through voltage-gated channels. Osteoarthritis Cartilage. 2009;17:397–405. doi: 10.1016/j.joca.2008.07.001. [PubMed] [Cross Ref]
52. Kawano S, et al. Characterization of Ca(2+) signaling pathways in human mesenchymal stem cells. Cell Calcium. 2002;32:165–74. doi: 10.1016/S0143416002001240. [PubMed] [Cross Ref]
53. Curtis TM, Scholfield CN. Nifedipine blocks Ca2+ store refilling through a pathway not involving L-type Ca2+ channels in rabbit arteriolar smooth muscle. J Physiol. 2001;532:609–23. doi: 10.1111/j.1469-7793.2001.0609e.x. [PMC free article] [PubMed] [Cross Ref]
54. Wen L, et al. L-type calcium channels play a crucial role in the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells. Biochem Biophys Res Commun. 2012;424:439–45. doi: 10.1016/j.bbrc.2012.06.128. [PubMed] [Cross Ref]
55. Zhang J, Li M, Kang ET, Neoh KG. Electrical stimulation of adipose-derived mesenchymal stem cells in conductive scaffolds and the roles of voltage-gated ion channels. Acta Biomater. 2016;32:46–56. doi: 10.1016/j.actbio.2015.12.024. [PubMed] [Cross Ref]
56. Lin SS, et al. Cav3.2 T-type calcium channel is required for the NFAT-dependent Sox9 expression in tracheal cartilage. Proc Natl Acad Sci USA. 2014;111:E1990–8. doi: 10.1073/pnas.1323112111.[PMC free article] [PubMed] [Cross Ref]
57. Guilak F, Leddy HA, Liedtke W. Transient receptor potential vanilloid 4: The sixth sense of the musculoskeletal system? Ann N Y Acad Sci. 2010;1192:404–9. doi: 10.1111/j.1749-6632.2010.05389.x.[PMC free article] [PubMed] [Cross Ref]
58. Maroto R, et al. TRPC1 forms the stretch-activated cation channel in vertebrate cells. Nat Cell Biol. 2005;7:179–85. doi: 10.1038/ncb1218. [PubMed] [Cross Ref]
59. Eleswarapu SV, Athanasiou KA. TRPV4 channel activation improves the tensile properties of self-assembled articular cartilage constructs. Acta Biomater. 2013;9:5554–61. doi: 10.1016/j.actbio.2012.10.031. [PMC free article] [PubMed] [Cross Ref]
60. Phan MN, et al. Functional characterization of TRPV4 as an osmotically sensitive ion channel in porcine articular chondrocytes. Arthritis Rheum. 2009;60:3028–37. doi: 10.1002/art.24799.[PMC free article] [PubMed] [Cross Ref]
61. Hung CT. Transient receptor potential vanilloid 4 channel as an important modulator of chondrocyte mechanotransduction of osmotic loading. Arthritis Rheum. 2010;62:2850–1. doi: 10.1002/art.27617.[PubMed] [Cross Ref]
62. Kurth F, et al. Transient receptor potential vanilloid 2-mediated shear-stress responses in C2C12 myoblasts are regulated by serum and extracellular matrix. FASEB J. 2015;29:4726–37. doi: 10.1096/fj.15-275396. [PubMed] [Cross Ref]
63. Clapham DE, Runnels LW, Strubing C. The TRP ion channel family. Nat Rev Neurosci. 2001;2:387–96. doi: 10.1038/35077544. [PubMed] [Cross Ref]
64. Somogyi CS, et al. Polymodal Transient Receptor Potential Vanilloid (TRPV) Ion Channels in Chondrogenic Cells. Int J Mol Sci. 2015;16:18412–38. doi: 10.3390/ijms160818412. [PMC free article][PubMed] [Cross Ref]
65. Muramatsu S, et al. Functional gene screening system identified TRPV4 as a regulator of chondrogenic differentiation. J Biol Chem. 2007;282:32158–67. doi: 10.1074/jbc.M706158200. [PubMed] [Cross Ref]
66. Gavenis K, et al. Expression of ion channels of the TRP family in articular chondrocytes from osteoarthritic patients: changes between native and in vitro propagated chondrocytes. Mol Cell Biochem. 2009;321:135–43. doi: 10.1007/s11010-008-9927-x. [PubMed] [Cross Ref]
67. Torossian F, Bisson A, Vannier JP, Boyer O, Lamacz M. TRPC expression in mesenchymal stem cells. Cell Mol Biol Lett. 2010;15:600–10. doi: 10.2478/s11658-010-0031-3. [PubMed] [Cross Ref]
68. Lievremont JP, Bird GS, Putney JW., Jr. Mechanism of inhibition of TRPC cation channels by 2-aminoethoxydiphenylborane. Mol Pharmacol. 2005;68:758–62. [PubMed]
69. Yang Z, et al. Improved mesenchymal stem cells attachment and in vitro cartilage tissue formation on chitosan-modified poly(L-lactide-co-epsilon-caprolactone) scaffold. Tissue Eng Part A. 2012;18:242–51. doi: 10.1089/ten.tea.2011.0315. [PMC free article] [PubMed] [Cross Ref]
70. Winegar BD, Haws CM, Lansman JB. Subconductance block of single mechanosensitive ion channels in skeletal muscle fibers by aminoglycoside antibiotics. J Gen Physiol. 1996;107:433–43. doi: 10.1085/jgp.107.3.433. [PMC free article] [PubMed] [Cross Ref]
ASAIO J. 2018 Mar/Apr;64(2):253-260. doi: 10.1097/MAT.0000000000000631.

Synergism of Electrospun Nanofibers and Pulsed Electromagnetic Field on Osteogenic Differentiation of Induced Pluripotent Stem Cells.

Ardeshirylajimi A1, Khojasteh A.

Author information

1
From the Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Abstract

According to the current therapies failure for bone fractures and lesions, tissue engineering showed a great potential to help solve these challenges. Because the use of growth factors is very limited in the clinic, it could be very useful that could be introducing an alternative to it. Extremely low frequency pulsed electromagnetic fields (PEMF, 1 mT, 50 Hz) were used for achieving this aim. The PEMF potential in combination with electrospun polycaprolactone (PCL) nanofibers was used to investigate the osteogenic potential of human induced pluripotent stem cells (iPSCs). Several relevant osteogenic markers, such as Alizarin red staining, alkaline phosphatase activity, calcium content, gene expression, and immunocytochemistry, were used to evaluate osteoinductivity of PEMF. Results were shown that PEMF alone can induce osteogenic differentiation, but this capability increased when used in combination with PCL nanofibers significantly. In addition, simultaneous use of osteogenic medium, PEMF and PCL surprisingly increased osteogenic differentiation potential of iPSCs. According to the results, PEMF alone, iPSCs-seeded PCL, and both of them could be considered as a promising candidate for use in bone tissue engineering applications.

J Physiol Pharmacol. 2017 Apr;68(2):253-264.

Changes in viability of rat adipose-derived stem cells isolated from abdominal/perinuclear adipose tissue stimulated with pulsed electromagnetic field.

Baranowska A1, Skowron B1, Nowak B2, Ciesielczyk K1, Guzdek P3, Gil K1, Kaszuba-Zwoinska J4.

Author information

1
Department of Pathophysiology, Jagiellonian University Medical College, Cracow, Poland.
2
Department of Immunology, Jagiellonian University Medical College, Cracow, Poland.
3
Institute of Electron Technology, Cracow, Poland.
4
Department of Pathophysiology, Jagiellonian University Medical College, Cracow, Poland. jkaszuba@cm-uj.krakow.pl.

Abstract

Previous experiments demonstrated that low-frequency electromagnetic field (LF-EMF) may activate cellular death pathways in proliferating cells. Therefore, we hypothesized that LF-EMF may also influence viability of highly proliferating undifferentiated adipose-derived stem cells. Obesity is classified as a civilization disease; its etiopathogenesis is presumed to include both genetic predisposition and influence of modified environmental factors, such as unbalanced diet with excess calories and/or too low physical activity. Obesity may lead to a number of metabolic disorders, including type 2 diabetes mellitus, cardiovascular diseases (associated with atherosclerosis) related to primary hypertension and ischemic heart disease, myocardial infarction and other complications. The aim of this study was to verify if LF-EMF alters viability parameters of adipose-derived stem cells (ADSCs) isolated from rats, cultured in vitro and exposed to pulsed electromagnetic field (PEMF; 7 Hz, 30 mT). ADSCs were obtained from healthy rats and animals with experimentally-induced obesity, both males and females, pups and adults. The animals were fed with chow with either low (LF diet) or high fat content (HF diet) for 21 days. Then, ADSCs were isolated from extracted adipose tissue and used to establish cell cultures. ADSCs from the first passage were exposed to PEMF three times, 4 hours per exposure, at 24-h intervals (experimentally developed protocol of PEMF stimulation). 24 hours after the last exposure to PEMF, viability parameters of ADSCs were analyzed by flow cytometry (FCM). The study demonstrated that LF diet exerted a protective effect on PEMF-exposed ADSCs, especially in the case of male and female pups. In turn, the proportion of early apoptotic cells in PEMF-treated ADSC cultures from adult female rats maintained on HF diet turned out to be significantly higher than in other experimental groups.

Logo of sci

Stem Cells International
Stem Cells Int. 2017; 2017: 2450327.
Published online 2017 Apr 23. doi:  10.1155/2017/2450327
PMCID: PMC5420424
PMID: 28512472

Pulsed Electromagnetic Field Regulates MicroRNA 21 Expression to Activate TGF-? Signaling in Human Bone Marrow Stromal Cells to Enhance Osteoblast Differentiation

Nagarajan Selvamurugan, 1 Zhiming He, 2 Daniel Rifkin, 3 Branka Dabovic, 3 and Nicola C. Partridge 2 , *
Author information ? Article notes ? Copyright and License information ? Disclaimer

Abstract

Pulsed electromagnetic fields (PEMFs) have been documented to promote bone fracture healing in nonunions and increase lumbar spinal fusion rates. However, the molecular mechanisms by which PEMF stimulates differentiation of human bone marrow stromal cells (hBMSCs) into osteoblasts are not well understood. In this study the PEMF effects on hBMSCs were studied by microarray analysis. PEMF stimulation of hBMSCs’ cell numbers mainly affected genes of cell cycle regulation, cell structure, and growth receptors or kinase pathways. In the differentiation and mineralization stages, PEMF regulated preosteoblast gene expression and notably, the transforming growth factor-beta (TGF-?) signaling pathway and microRNA 21 (miR21) were most highly regulated. PEMF stimulated activation of Smad2 and miR21-5p expression in differentiated osteoblasts, and TGF-? signaling was essential for PEMF stimulation of alkaline phosphatase mRNA expression. Smad7, an antagonist of the TGF-? signaling pathway, was found to be miR21-5p’s putative target gene and PEMF caused a decrease in Smad7 expression. Expression of Runx2 was increased by PEMF treatment and the miR21-5p inhibitor prevented the PEMF stimulation of Runx2 expression in differentiating cells. Thus, PEMF could mediate its effects on bone metabolism by activation of the TGF-? signaling pathway and stimulation of expression of miR21-5p in hBMSCs.

1. Introduction

Abundant reports describe the effects of electricity on bone growth and fracture repair, and a variety of pulsed electromagnetic field (PEMF) devices have been developed to produce electromagnetic fields at the fracture site. These widespread PEMF devices utilize noninvasive inductive coupling and can be used along with every method of fracture fixation []. The stimulation of bone at the fracture site by the introduction of electromagnetic fields may be similar to the resulting stimulation from mechanical loading []. The beneficial therapeutic effects of such selected low energy, time varying PEMF promote fracture healing in nonunions [], increase lumbar spinal fusion rates [], and have been found to affect bone metabolism by decreasing bone resorption and increasing bone formation []. PEMFs have also been reported to stimulate the synthesis of extracellular matrix (ECM) proteins [] and may also affect several membrane receptors including those for parathyroid hormone, low density lipoprotein, insulin-like growth factor-2, insulin, and calcitonin []. Several growth factors such as bone morphogenetic proteins 2 and 4 (BMP-2, BMP-4) and transforming growth factor-beta (TGF-?) have been reported to be secreted from osteoblasts upon PEMF treatment []. It has been shown that electromagnetic stimulation could raise net Ca2+ flux in human osteoblast-like cells, and the increase in the cytosolic Ca2+ concentration could initiate activation of signaling pathways resulting in regulation of expression of bone matrix genes []. Accelerated osteogenesis has been found in bone marrow-derived mesenchymal stem cells by PEMF treatment [] and this promotion of ECM deposition was more efficient compared with adipose-tissue mesenchymal stem cells [].

Previously we have reported that both BMP-2 and PEMF (Spinal-Stim® by Orthofix, Inc., Lewisville, TX) separately stimulated proliferation of rat primary calvarial osteoblastic cells and stimulated expression of early osteoblast differentiation genes in culture []. In this study, we investigated the effects of PEMF (Cervical-Stim® by Orthofix, Inc., Lewisville, TX) on human bone marrow stromal cells (hBMSCs) proliferating and differentiated to osteoblastic cells. In addition, the underlying molecular mechanisms by which PEMF stimulates differentiation of hBMSCs into osteoblasts are not well understood. Thus, we also aimed to investigate the PEMF effects on proliferation, differentiation, and mineralization of hBMSCs by Affymetrix microarray analysis. The TGF-? signaling pathway and microRNA 21 (miR21) were most highly regulated by PEMF. Thus, in this study we systematically investigated the mechanism of action of PEMF effects on osteogenesis via TGF-? and miR21 using hBMSCs.

2. Materials and Methods

2.1. Cell Culture

Fresh human bone marrows from 21–68-year-old women were used. These were either purchased from Lonza (Walkersville, MD) or left over tissue from surgical procedures at New York University Hospital for Joint Diseases. Since these were deidentified, this is not considered Human Subjects Research by the New York University School of Medicine Institutional Review Board. In both cases, the bone marrows were freshly collected, never frozen, and immediately diluted 1?:?1 in Hank’s Balanced Salt Solution (HBSS; GIBCO Laboratories, Grand Island, NY) containing 20?IU/mL of sodium heparin (Sigma Chemical Co., St. Louis, MO). The diluted bone marrow was layered over an equal volume of Ficoll-Paque Plus (GE Healthcare, Piscataway, NJ) and centrifuged at 400g for 40?min at 18°C. The mononuclear cells at the interface layer were collected, washed three times with HBSS, resuspended and seeded into a tissue culture flask, and incubated at 37°C in the presence of 5% CO2 overnight. The next day, nonadherent cells were removed from the culture flask. Adherent cells (BMSCs) were grown to confluence then placed in 6-well plates at 6.4 × 104?cells/well for exposure to PEMF or control. All cells were incubated at 37°C in the presence of 5% CO2. The medium used for culturing these cells was ?-MEM (Corning, Tewksbury, MA) containing 15% fetal bovine serum (FBS; GIBCO, Grand Island, NY) and Penicillin-Streptomycin (GIBCO, Grand Island, NY).

2.2. PEMF Exposure

The PEMF was generated as previously described [] but was set to have similar waveform characteristics to a commercial, clinically approved proprietary device (Cervical-Stim by Orthofix Inc., Lewisville, TX). Cervical-Stim is the only device approved by the FDA for cervical fusion use and has been reported to be safe and effective []. The specific differences from our previous publication [] were a burst frequency of 15?Hz and a burst period of 67?ms. The induced magnetic field was vertical relative to the surface of the plates. The PEMF waveform was routinely checked for its consistency using a field probe and oscilloscope. The first PEMF exposure was initiated 24?h after seeding cells in wells (day 1) and continued through the entire experiment. Control plates were placed in an identical incubator on Plexiglas shelves. The CO2 concentration, humidity, and temperature of the control and treatment incubators (upper and lower chambers of the same double incubator) were identical and were not affected by the PEMF.

2.3. Cell Number

Cells were grown in normal growth medium and were trypsinized, resuspended, and counted using a hemocytometer when they reached 70–80% confluence on day 10 or 20 of culture, respectively, for the BMSCs from the younger (21–30) women versus those from the 31–65-year-old women.

2.4. Osteoblast Differentiation

Human BMSCs were seeded at 6.4 × 104 cells/well in 6-well cell culture plates and cultured for 10 days or 20 days in normal cell culture medium (?MEM + 15% FBS + 1% Penn/Strep) before they reached confluence. They were then cultured for an additional 13 (differentiation) or 23 (mineralization) days in osteogenic medium [normal growth medium supplemented with 10?4?M L-ascorbic acid, 10?8?M dexamethasone, and 1.80?mM potassium phosphate monobasic (Sigma, St. Louis, MO)]. The medium was changed three times/week.

2.5. Von Kossa Staining

For Von Kossa staining, 6 replicates of BMSCs were treated with PEMF or control daily from day 1 of culture. On day 23, 33, or 43, the cells were fixed with 95% ethanol for 15?min at 37°C, then rinsed and rehydrated through 80%, 50%, and 20% ethanol and then water, and incubated with 5% silver nitrate solution for 1?h at 37°C. The cells were rinsed with water, exposed to UV light for 10?min, and photographed. Von Kossa staining was analyzed by computer based morphometry (ImageJ: NIH, Bethesda, Maryland).

2.6. Extracellular Regulated Kinases Activation and Western Blot Analyses

Human BMSCs treated with control or PEMF for 5 and 10 days in the proliferation phase were washed with cold phosphate buffered saline (PBS) and lysed in Cell Lysis Buffer (Invitrogen, Grand Island, NY) containing protease and phosphatase inhibitor cocktails (Sigma). Cell lysates were centrifuged at 10,000?rpm for 10 minutes at 4°C and supernatants were saved and used for Western blot analysis. Twenty ?g of total cell protein was loaded per well and separated on 4–15% Mini-Protean TGX precast gels (Bio-Rad, Hercules, CA), followed by transferring to nitrocellulose membranes (Bio-Rad, Hercules, CA). The membranes were blocked and incubated with primary rabbit antibodies (Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204), p44/42 MAPK (Erk1/2) (137F5), or Cdk2 (sc-163; Cyclin dependent kinase 2, loading control)) overnight at 4°C. The membranes were then probed with secondary antibody conjugated with horseradish peroxidase. Finally, the bands were visualized by adding Super Signal West Dura Extended Duration Substrate (Thermo Scientific, Pittsburgh, PA) according to the manufacturer’s instructions. The primary antibodies to total ERKs and phosphorylated ERKs were obtained from Cell Signaling Technology (Danvers, MA), while the antibody to Cdk2 was obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX). The secondary antibody (goat-anti-rabbit) conjugated with horseradish peroxidase (HRP) was obtained from Santa Cruz Biotechnology. Results were captured and quantitated by ChemiDoc XRS+ software (Bio-Rad, Hercules, CA). Both the Phospho-ERK1/2 and total ERK 1/2 were normalized to Cdk2 and then expressed as a percent of the values obtained in untreated control cells.

2.7. Microarray Assays

Human BMSCs of a 27-year-old healthy female donor were used for microarray experiments. Only hBMSCs expanded from the second to sixth passages were used for the experiments. PEMF treatment (Cervical-Stim) was initiated 24?h after hBMSCs were seeded, with 4?h daily exposure every day throughout the experimental period. Quadruplicate cell samples from both PEMF-treated and control groups were collected simultaneously at time points of hBMSC proliferation, osteoblast differentiation, and mineralization phases. Total RNA was isolated from cells by using TRIzol reagent (Thermo Scientific, Pittsburgh, PA) and then purified with RNeasy mini kit from Qiagen (Valencia, CA). Prior to microarray analysis, the RNA integrity was assessed by Agilent 2100 Bioanalyzer (Santa Clara, CA) and the best quality triplicate samples were chosen for the subsequent analyses. Microarrays and data analyses with Affymetrix Human U133 plus 2.0 Gene Chips (Santa Clara, CA) were performed at University of Medicine and Dentistry of New Jersey Genome Center according to the manufacturer’s instructions. In the case of gene expression where it was significantly found to be above 1.5-fold after PEMF treatment, gene ontology analysis was carried out by DAVID Bioinformatics Resources 6.7 software (NIAID, NIH).

2.8. Real-Time RT-PCR

Total RNA was isolated from cells using the total RNA isolation kit from Qiagen (Valencia, CA). For determination of expression of genes other than miR21-5p, 100?ng of total RNA from each sample was used for cDNA synthesis using TaqMan Reverse Transcription Reagents (Roche, Indianapolis, IN). Quantitative (q)PCR reactions were performed according to the real-time thermocycler machine (Realplex) manufacturer’s instructions (Eppendorf, Hauppauge, NY), which allowed real-time quantitative detection of the PCR products by measuring the increase in SYBR green fluorescence caused by binding of SYBR green to double-stranded DNA. The Power SYBR green master mix kit for PCR reactions was purchased from Invitrogen. The qPCR was performed in triplicate with reaction conditions of 95°C, 10?min, 1 cycle; 95°C, 15?sec; and 58.5°C, 1?min, for 40 cycles. Gene expression was analyzed with threshold cycle (CT) values averaged from triplicate samples and normalized to their CT values of housekeeping gene RPL13A. Primers were designed by NCBI primer Blast software. Table 1 lists the human-specific primers used for PCR amplification.

Table 1

Primers used in this study.

Gene name Forward primer (5? > 3?) Reverse primer (5? > 3?)
ALP TGGACGGCCTGGACCTCGTT AGGGTCAGGAGTTCCGTGCG
COL1A1 GGAGGCACGCGGAGTGTGAG CCTCTTGGCCGTGCGTCAGG
Osteocalcin GAGCCCCAGTCCCCTACCCG GACACCCTAGACCGGGCCGT
FOSB GCGCCGGGAACGAAATAAAC TTCGTAGGGGATCTTGCAGC
LEPR GTGGGGCTATTGGACTGACT CTTTGAGAGTCCAGCAGGCA
TBRG1 GCTAGATTCCTAGAGGCCCG GGCATCGGATCCTAAGTCGG
FBN2 CTTTAGGCCGGTTATGCAACG AATAAGCCCTTCGTCGGCTC
SOX11 TTGGAAGCGGAGAGCAACCT TGCGTTCGATCTTGGACCAT
CTNNA1 GGCAGCCAAAAGACAACAGG GGCCTTATAGGCTGCGACAT
AKT3 CTCTATTATTTGGGCTGAGTCATCA CCCCTCTTCTGAACCCAACC
CXCL12 GACAAGTGTGCATTGACCCG TGTAAGGGTTCCTCAGGCGT
THBS1 CCTCTACTCCGGACGCAC GCCCCGGTGAGTTCAAAGAT
COL5A1 CGGGGACTATGACTACGTGC CTCCAAGTCATCCGCACCTT
GPC4 CAGAGGTCCAGGTTGACACC TCGGCTTTCTCATTGGCACT
MMP16 TGCGGAACGGAGCAGTATTT TGTGCTTGTGCTGCCATTTC
TGFB2 CCCCGGAGGTGATTTCCATC AACTGGGCAGACAGTTTCGG
CDH11 CCCAGTACACGTTGATGGCT ACGTTCCCACATTGGACCTC
SPP1 GCCTCCTAGGCATCACCTG CTTACTTGGAAGGGTCTGTGGG
IL8 GGTGCAGTTTTGCCAAGGAG TTCCTTGGGGTCCAGACAGA
RPL13A AAGTACCAGGCAGTGACAG CCTGTTTCCGTAGCCTCATG
hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA

For miR21-5p and snoR10-1, the reagents and primer sets for RT-qPCR were purchased from Qiagen. One ug of total RNA was reverse-transcribed into cDNA using the miScript II kit with miScript HiSpec Buffer according to the manufacturer’s instructions. The cDNA was then diluted 10 times and utilized as a template to amplify miR21-5p and snoR10-1 with the miScript SYBR Green PCR kit using the appropriate primers. snoR10-1 was used as normalizing gene control. The qPCR was performed in triplicate with reaction conditions of 95°C 15?min for Taq DNA polymerase activation, 94°C 15?sec denaturation, 55°C 30?sec annealing, and 70°C 30?sec extension for 40 cycles. Gene expression results of miR21-5p from either control or PEMF-treated groups were normalized to their relative snoR10-1 results.

2.9. TGF-? Signaling

Human BMSCs were cultured and treated with control or PEMF as described above. For TGF-? and BMP signaling assays, osteoblasts were treated with PEMF at days 23 and 33 and were also treated with TGF-?2 (R&D System, Minneapolis, MN) as a positive control for the TGF-? pathway. The day before assay, the cells were starved overnight (0.1% FBS medium) to reduce endogenous signaling activity. At day 23 at the same time as PEMF exposure started, 5?ng/mL TGF-?2 was added to the medium of positive control wells. Cell lysates from different groups were collected at 0, 2, and 4?h time points after treatment to examine Smad2, Smad3, and Smad1/5/8 protein phosphorylation by Western blot analysis as described above. Phospho-Smad2 (Ser465/467, 138D4)/Smad2 (D43B4), phospho-Smad3 (Ser423/425, C25A9)/Smad3 (C67H9), and phospho-Smad1/5/8/Smad1/5 antibodies were obtained from Cell Signaling Technology (Danvers, MA). In TGF-? neutralization experiments, 30?ug/mL normal rabbit IgG or TGF-? pan antibody (R&D System, Minneapolis, MN) was added to osteogenic medium during the entire differentiation period. At day 23, two non-PEMF-treated cell groups were also included with 5?ng/mL of TGF-?2 as positive controls. After 2?h of PEMF exposure, all sample groups were collected for Western blots and RT-qPCR assays.

2.10. Transient Transfection

Cells were seeded in growth medium in 6-well plates at a density of 105?cells/well on the day before the transfection. miR-21 is now referred as miR-21-5p, based on the latest miRBase release (V.21). miR21-5p inhibitor (Applied Biosystems: 4464084) designed to bind with endogenous miR21, when introduced into cells, inhibits its activities. miR21-5p mimic (Applied Biosystems: 4464066) was designed to be similar to that of endogenous miR21. A negative control miRNA (Applied Biosystems: 4464076) was included in the study. The X-treme Gene transfection reagent obtained from Roche, USA, was mixed with 50?nM of negative control miRNA, miR21 mimic, or miR21 inhibitor, and transient transfection was carried out [] for 3 or 6 days along with PEMF treatment every day for 4?h.

2.11. Statistical Analysis

Statistical analysis was done by one-way ANOVA, Student’s t-test, or Wilcoxon Ranking. Significant difference is p < 0.05. All data are shown as mean ± standard deviation with n as indicated.

3. Results

3.1. PEMF Effects on Proliferation and Differentiation of Human BMSCs from Subjects of Different Ages

We previously reported that PEMF generated by Spinal-Stim stimulated cell proliferation and expression of early differentiation marker genes in rat primary calvarial osteoblastic cultures []. In the present study we used PEMF (Cervical-Stim) to determine its effect on osteoblasts using human bone marrow cells. PEMF significantly stimulated the cell number of preosteoblasts from BMSCs of young women (21–30 years old) while not stimulating those of BMSCs from 31–65-year-old women (Figures 1(a) and 1(b)). It should also be noted that the hBMSCs from aged individuals (58, 59, and 65 years old) also required much longer time (20 days) to approach a similar cell culture density to those from the younger women. Since PEMF had an effect on preosteoblastic cell number from the younger women and cell proliferation involves activation of intracellular signaling pathways, especially extracellular regulated kinases (ERKs), we determined activation of these enzymes by PEMF. As shown in Figure 2(a), PEMF increased ERK activation (phosphorylation) after 15?min on day 5 in BMSCs from a 24-year-old woman. A similar effect was also found in hBMSCs from other younger female subjects (24- and 27-year-old women’s cells) and the quantitative analysis of ERK activation (phosphorylated ERKs) from the three individuals after normalization to total ERKs confirmed the above result (Figure 2(b)). There was no significant activation of ERKs from any of these cells on the 10th day of PEMF treatment (Figures 2(c) and 2(d)).

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.001.jpg

Effect of PEMF on hBMSC preosteoblastic cell number. (a) Human preosteoblasts derived from bone marrow stromal cells of 21–36-year-old women were treated with PEMF for 10 days; cells from 58-, 59-, and 65-year-old women were treated with PEMF for 20 days. Cell number/well was calculated using a hemocytometer (n = 3–6 wells). (b) Aggregation of the data into the two age groups, n = 5-6. The statistical p value for the younger versus older samples is shown using Student’s t-test analysis.

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.002.jpg

Effect of PEMF on ERK activation. Human BMSCs from two different 24-year-old women and a 27-year-old woman were subjected to 4?h daily PEMF treatment for either 4 days or 9 days. On the 5th (a) or 10th day (c), their cells were treated with PEMF for different time periods as indicated and whole cell lysates were obtained and subjected to Western blot analyses; cells from a 24-year-old woman are shown as an example. ((b) day 5, (d) day 10) The quantitation of activated or phosphorylated ERKs for cells from 2 separate 24-year-old women and a 27-year-old woman was determined by normalization of phosphorylated ERKs to total ERKs after normalization to Cdk2 as a loading control and expressed as a percent of untreated control cells. The results are shown for the cells of the 3 individuals. ? indicates significant increase compared to control. # indicates significant increase compared to 0 times of PEMF on the 5th day. The p value ? 0.05 is considered as significant using one-way ANOVA.

To determine the role played by PEMF in osteoblast differentiation and mineralization of hBMSCs, experiments were carried out at molecular and cellular levels. At the molecular level, the mRNA expression of alkaline phosphatase (ALP), type I collagen (COL1A1), and osteocalcin (OC), which are known osteoblast differentiation and mineralization marker genes, was determined using qRT-PCR analysis. PEMF significantly increased mRNA expression of ALP and Col1 but not OC in BMSCs that had been allowed to proliferate, differentiate, and mineralize (Figure 3(a)). We next determined the effect of PEMF on mineralization in BMSCs by Von Kossa staining (Figures 3(b) and 3(c)). PEMF significantly stimulated mineralization of BMSCs in the mineralization phase and did not in the differentiation phase.

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.003.jpg

Effect of PEMF on expression of osteoblastic marker genes and mineralization in hBMSCs. Differentiating preosteoblasts from 24–68-year-old women were grown in the presence of osteoblast differentiation medium after confluence was reached and were treated with PEMF for 33 days or 43 days (59–68-year-old samples) of culture. (a) Total RNA was isolated and subjected to qRT-PCR using specific primers for human ALP, type I collagen, OC, and RPL13A. n = 9. (b) Cells were then subjected to Von Kossa staining and the mineralized calcium deposits were quantified. n = 9. Statistical analyses were conducted using Wilcoxon signed rank test. The p value ? 0.05 is considered as significant compared with the controls. (c) An example of Von Kossa staining and mineralized calcium deposits for hBMSCs of a 24-year-old female after 33 days of osteogenic culture in the presence or absence of daily Cervical-Stim PEMF.

3.2. PEMF Regulation of Genes during hBMSC Proliferation by Microarray Analysis

A sample from a young individual was used for microarray analyses because PEMF significantly enhanced cell growth for young individuals compared to old individuals as shown in Figure 1. For assessment of the effect of PEMF on gene expression during hBMSC proliferation, on the 5th day of PEMF treatment 2?h after initiating the PEMF signal (pilot studies had shown significant PEMF stimulation of Cyclin gene expression at this time and day, data not shown), total RNA was isolated and used for the subsequent test with Affymetrix Human U133 plus 2.0 Gene Chips. After identifying significantly regulated genes, gene ontology analyses were performed by DAVID Bioinformatics Resources 6.7 software. The results indicated that PEMF stimulation of proliferating hBMSCs mainly affected genes of cell cycle regulation, cell structure, extracellular matrix (ECM), and some growth receptors or kinase pathways. There were a total of 114 known genes upregulated and 17 known genes downregulated at this time point (partially listed in Table 2). We have also included the decrease in fibrillin 2, even though it was not ?1.5-fold, since this sequesters members of the TGF-? family and is the subject of our later research in this report.

Table 2

Genes regulated by PEMF during hBMSCs proliferation by microarray analysis. Cells were from a normal 27-year-old female. Total RNA was isolated at day 5 after 2?h of PEMF treatment and used for microarray assays as described in Materials and Methods. Analysis by Student’s t-test.

Gene symbol Gene title Fold-change
(Avg PEMF versus avg controls)
p
Cell adhesion and binding and cytoskeletal and structural proteins
MMP1 Matrix metallopeptidase 1 (interstitial collagenase) 4.57 2.16E ? 03
PRC1 Protein regulator of cytokinesis 1 3.22 4.34E ? 04
CCBE1 Collagen and calcium binding EGF domains 1 2.97 1.32E ? 04
CLDN1 Claudin 1 2.71 2.26E ? 04
CENPK Centromere protein K 2.40 5.36E ? 03
GAS2L3 Growth arrest-specific 2 like 3 2.39 4.74E ? 03
CLDN11 Claudin 11 2.31 5.59E ? 04
NUSAP1 Nucleolar and spindle associated protein 1 2.16 5.04E ? 03
COL15A1 Collagen, type XV, alpha 1 2.12 1.64E ? 04
HAPLN1 Hyaluronan and proteoglycan link protein 1 2.03 1.37E ? 04
IBSP Integrin-binding sialoprotein 1.97 2.17E ? 03
FBN2 Fibrillin 2 ?1.12 1.98E ? 02
COL14A1 Collagen, type XIV, alpha 1 ?2.30 1.56E ? 02
MMP12 Matrix metallopeptidase 12 (macrophage elastase) ?3.27 1.19E ? 04
MGP Matrix Gla protein ?3.98 2.80E ? 06

p53 signaling pathway, apoptosis, and survival antiapoptotic TNFs/NF-kB/IAP pathway
BIRC5 Baculoviral IAP repeat containing 5 3.30 3.60E ? 06
GTSE1 G-2 and S-phase expressed 1 2.48 1.02E ? 03
SESN3 sestrin 3 ?2.47 3.72E ? 07

Cell cycle role of APC ?(anaphase-promoting complex) in cell cycle regulation, cell cycle/checkpoint control
CDK1 Cyclin-dependent kinase 1 5.07 1.01E ? 03
CDC20 Cell division cycle 20 homolog (S. cerevisiae) 3.00 3.32E ? 04
CCNB2 Cyclin B2 2.41 1.83E ? 03
NDC80 NDC80 kinetochore complex component homolog (S. cerevisiae) 2.38 7.59E ? 04
TYMS Thymidylate synthetase 2.36 9.43E ? 05
CCNB1 Cyclin B1 2.35 2.17E ? 03
NEK2 NIMA- (never in mitosis gene a-) related kinase 2 2.12 2.19E ? 02
CCNA2 Cyclin A2 1.95 6.42E ? 03
TTK TTK protein kinase 1.95 1.77E ? 02

Akt signaling
CCL2 Chemokine (C-C motif) ligand 2 2.83 6.76E ? 05
CSF2RB Colony stimulating factor 2 receptor, beta, low-affinity 2.31 2.04E ? 03

Other receptor, kinase, and regulator
CDKN3 Cyclin-dependent kinase inhibitor 3 2.45 2.32E ? 04
PDGFRA Platelet-derived growth factor receptor, alpha polypeptide 2.26 2.52E ? 05
CTSC Cathepsin C 2.14 5.32E ? 04
LEPR Leptin receptor ?2.19 1.46E ? 04
FGFR2 Fibroblast growth factor receptor 2 ?2.04 8.83E ? 05

3.3. PEMF Regulation of Genes in Differentiated and Mineralized hBMSCs by Microarray Analysis

In the differentiation (day 23) and mineralization stages (day 33) after daily 4?h PEMF treatment, a total of 37 (partially listed in Table 3) and 173 (partially listed in Table 4) known genes, respectively, were identified as significantly regulated. In these two stages, PEMF regulated preosteoblast gene expression and most genes were downregulated including transcriptional regulators, metabolism, proteases, and regulators and also cell adhesion and binding proteins and cytoskeletal and structural proteins. Changes in gene transcription of candidate genes chosen from microarray analyses were verified and confirmed by RT-qPCR on RNA from differentiated hBMSCs from 3 females, aged 24, 27, and 31 years (Table 5). Notably, the TGF-? signaling pathway seems to be most highly regulated by PEMF. In particular, RT-qPCR showed that fibrillin 2 (FBN2) was significantly decreased in expression by 65 ± 14%, while TGF-?2 mRNA significantly increased to 155 ± 44% and TGF-? regulator 1 (TBRG1) mRNA significantly increased to 143 ± 23%, relative to controls. In contrast, in mineralizing cells (Table 6), there was no decrease in FBN2 expression and a lesser significant increase in TGF-?2. It appears that PEMF stimulated a number of components of the TGF-? pathway in differentiating and mineralizing osteoblasts. It is notable that no components of the BMP pathway were seen to be regulated.

Table 3

Genes regulated by PEMF in differentiating hBMSCs. Cells were from a normal 27-year-old female. Total RNA was isolated at day 23 of PEMF treatment. Analysis by Student’s t-test.

Gene symbol Gene title Fold-change
(Avg PEMF versus avg controls)
p
Transcriptional regulator, RNA metabolism, and RNA transport
SPEN Spen homolog, transcriptional regulator (Drosophila) ?1.74 2.68E ? 02
FOXO3, FOXO3B Forkhead box O3; forkhead box O3B pseudogene ?1.87 3.04E ? 02
MIR21 MicroRNA 21 1.61 2.92E ? 02

Metabolic process
AKT3 v-akt murine thymoma viral oncogene homolog 3 ?1.58 2.39E ? 02

Growth factor and regulator
TBRG1 Transforming growth factor beta regulator 1 1.72 9.85E ? 03

Receptor
LEPR Leptin receptor 1.55 5.20E ? 03

Cell adhesion, motility, and cytoskeletal
ARPC5 Actin related protein 2/3 complex, subunit 5, 16?kDa 1.50 1.93E ? 02
FBN2 Fibrillin 2 ?1.45 1.47E ? 02

Signaling transduction, pathway
THBS1 Thrombospondin 1 ?1.24 1.33E ? 02

Table 4

Genes regulated by PEMF in mineralizing hBMSCs. Cells were from a normal 27-year-old female. Total RNA was isolated at day 33 of PEMF treatment. Analysis by Student’s t-test.

Gene symbol Gene title Fold-change
(Avg PEMF versus avg controls)
p
Cell adhesion, motility, and cytoskeletal
COL1A2 Collagen, type I, alpha 2 ?1.60 1.81E ? 02
COL3A1 Collagen, type III, alpha 1 ?1.61 9.49E ? 03
FN1 Fibronectin 1 ?1.93 2.31E ? 04
FBN2 Fibrillin 2 1.38 2.49E ? 02
VIM Vimentin ?1.67 1.39E ? 02

Transcriptional regulator, RNA metabolism, and RNA transport
MIR21 MicroRNA 21 ?2.16 1.28E ? 02
HNRNPA1 LOC728844 Heterogeneous nuclear ribonucleoprotein ?1.91 1.41E ? 02

Cell cycle, cell growth, and apoptosis
CCNL1 Cyclin L1 ?1.79 1.65E ? 03
CCNL2 Cyclin L2 ?2.07 3.18E ? 03

Hormone, growth factor, and cytokine
CXCL12 Chemokine (CXC motif) ligand 12 stromal cell-derived factor 1 1.60 3.83E ? 03
IL15 Interleukin 15 ?1.55 4.70E ? 03
IL8 Interleukin 8 ?2.00 3.71E ? 02
TBRG1 Transforming growth factor beta regulator 1 ?2.35 8.96E ? 03
TGFB2 Transforming growth factor, beta 2 1.39 2.75E ? 02

Metabolic process
INSIG1 Insulin induced gene 1 1.52 2.36E ? 02

Signaling transduction, pathway
DAB2 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) ?1.62 3.65E ? 02
THBS1 thrombospondin 1 1.52 3.67E ? 03
TIFA TRAF-interacting protein with forkhead-associated domain ?1.51 3.02E ? 03

Protease and regulator
SERPINE1 Serpin peptidase inhibitor, clade E member 1 ?2.04 2.81E ? 03
BAG2 BCL2-associated athanogene 2 ?1.61 1.14E ? 03

Table 5

Real-time RT-PCR of three different female donor samples’ hBMSCs, aged 24, 27, and 31 years in the differentiation stage. Analysis by Student’s t-test.

Gene symbol Gene title Average PEMF/control % p
COL1A1 Collagen, type I, alpha 1 133 ± 24% 3.90E ? 02
COL5A1 Collagen, type V, alpha 1 136 ± 25% 3.44E ? 02
CTNNA1 Catenin (cadherin-associated protein), alpha 1, 102?kDa 124 ± 3% 8.27E ? 05
FOSB FBJ murine osteosarcoma viral oncogene homolog B 127 ± 33% 1.11E ? 01
SOX11 SRY- (sex determining region Y-) box 11 138 ± 24% 2.59E ? 02
SPP1 Secreted phosphoprotein 1 131 ± 41% 1.31E ? 01
TGFB2 Transforming growth factor, beta 2 155 ± 44% 4.87E ? 02
TBRG1 Transforming growth factor beta regulator 1 143 ± 23% 1.65E ? 02
AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 74 ± 15% 2.06E ? 02
FBN2 Fibrillin 2 35 ± 14% 7.38E ? 04
IL8 Interleukin 8 56 ± 35% 4.87E ? 02

Table 6

Real-time RT-PCR analysis of three different female donor samples’ hBMSCs, aged 24, 27, and 31 years in the mineralization stage. Analysis by Student’s t-test.

Gene symbol Gene title Average PEMF/control % p
CDH11 Cadherin 11, type 2, OB-cadherin (osteoblast) 130 ± 36% 1.10E ? 01
COL1A1 Collagen, type I, alpha 1 144 ± 47% 9.20E ? 02
CXCL12 Chemokine (C-X-C motif) ligand 12 146 ± 20% 8.48E ? 03
FBN2 Fibrillin 2 149 ± 54% 9.82E ? 02
FOSB FBJ murine osteosarcoma viral oncogene homolog B 165 ± 27% 6.97E ? 03
GPC4 Glypican 4 128 ± 25% 6.23E ? 02
IL8 Interleukin 8 162 ± 68% 9.49E ? 02
LEPR Leptin receptor 130 ± 19% 2.53E ? 02
MMP16 Matrix metallopeptidase 16 (membrane-inserted) 135 ± 68% 2.07E ? 01
SOX11 SRY- (sex determining region Y-) box 11 137 ± 37% 7.60E ? 02
SPP1 Secreted phosphoprotein 1 132 ± 52% 1.74E ? 01
TGFB2 Transforming growth factor, beta 2 128 ± 21% 3.99E ? 02
TBRG1 Transforming growth factor beta regulator 1 113 ± 14% 9.71E ? 02
THBS1 Thrombospondin 1 142 ± 58% 1.37E ? 01

3.4. PEMF Activation of TGF-? Signaling via Smad2 in Differentiated and Mineralizing Osteoblasts

To validate the PEMF effect on activation of the TGF-? signaling pathway, hBMSCs were subjected to differentiation (day 23) and mineralization (day 33) as described. During differentiation and mineralization, the cells were continuously treated with PEMF for 4?h each day. At days 23 and 33, cells were subjected to control, TGF-?2, or PEMF treatments for 0, 2, and 4?h. TGF-?2 was used as a positive control for activation of TGF-? signaling. Whole cell lysates were prepared and subjected to Western blot analyses using the antibodies for phosphorylated and total Smad2. The results show that PEMF stimulated activation of Smad2 by increased phosphorylation at day 23 in differentiated osteoblasts (Figure 4(a)) and less at day 33 in mineralizing osteoblasts (Figure 4(b)). To determine the specificity of activation of the TGF-?signaling by PEMF, osteoblasts were pretreated with pan-TGF-? antibody before PEMF treatment. The results show that the PEMF-stimulated Smad2 activation in differentiated osteoblasts (day 23) was blocked when cells were pretreated with pan-TGF-? antibody (Figure 4(c)). Since a recent paper has described a different PEMF signal as acting through the BMP pathway on rat calvarial osteoblasts [], we examined whether Smad1/5/8 was phosphorylated in response to the Cervical-Stim signal in hBMSCs (Figure 4(d)). We were unable to observe any stimulation of this pathway, in contrast to the activation of the Smad2 pathway, even though the strong positive control, TGF-?2, slightly stimulated Smad1/5/8 phosphorylation, as has been observed by others [].

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.004.jpg

PEMF resulted in activation of the TGF-? signaling pathway in human osteoblastic cells during differentiation and mineralization. (a) Whole cell lysates after PEMF treatment of hBMSCs of a 24-year-old female at day 23 (differentiation) and (b) at day 33 (mineralization) were subjected to Western blot analysis using the antibodies as indicated for Smad2 and Cdk2. TGF-?2 (5?ng/mL) was added to control (non-PEMF-treated) cells on days 23 and 33 as positive controls. (c) The pan-TGF-? neutralizing antibody (30?ug/mL) was added to the osteogenic medium of hBMSCs from a 24-year-old female during the entire differentiation period and lysates were prepared on day 23 of PEMF treatment, 2?h after PEMF was started or TGF-?2 was added and subjected to Western blot analysis. TGF-?2 (5?ng/mL) was added to control (non-PEMF-treated) cells on day 23 as a positive control. Cdk2 was used as loading control. (d) The same lysates were subjected to Western blot analysis for phosphorylation of Smad1/5/8 as indicated.

3.5. PEMF Stimulates Osteoblast Marker Gene Expression by Activation of the TGF-? Signaling Pathway

To determine if TGF-? signaling is responsible for the PEMF effect on expression of osteoblast differentiation marker genes such as ALP and type I collagen, this pathway was inhibited and RNA collected from differentiated osteoblasts at day 23 and subjected to RT-qPCR analysis. We found that PEMF significantly stimulated mRNA expression of ALP (Figure 5(a)) and type I collagen (Figure 5(b)) in differentiated osteoblasts. When cells were pretreated with pan-TGF-? antibody, PEMF stimulation of expression of these genes was significantly decreased (Figures 5(a) and 5(b)). Thus, this result indicates that the osteogenic effect of Cervical-Stim PEMF on hBMSCs is mediated via the TGF-? signaling pathway.

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.005.jpg

PEMF resulted in stimulation of expression of osteoblast differentiation marker genes via the TGF-? signaling pathway. Differentiated human osteoblasts derived from hBMSCs from a 30-year-old female were used. Total RNA was isolated after incubation with IgG or pan-TGF-? antibody (Pan-Anti) and treatment with control (Ctr) or PEMF and subjected to RT-qPCR using the primers for (a) ALP and (b) collagen 1A1 genes. RPL13 was used to normalize gene expression. n = 3. ? indicates significant increase compared with control IgG. # indicates significant decrease compared to all groups with ALP mRNA expression; ## indicates significant decrease compared to control or PEMF treatment with IgG incubation with collagen 1A1 mRNA expression; analysis by one-way ANOVA.

3.6. PEMF Stimulation of miR21-5p Expression in Differentiating Osteoblasts

MicroRNAs are considered to be regulators of osteogenesis and bone formation. The microarray analysis of hBMSCs subjected to differentiation at day 23 identified the stimulation of expression of miR21 (Table 3). To verify this, total RNA was obtained with differentiated hBMSCs from females aged 24 × 2, 27, 29, and 30 (young individuals) and 31, 36, 58, and 68 (older individuals) years and subjected to RT-qPCR. The result shows that the expression of miR21-5p was 155% increased in cells from the younger women but not significantly increased in cells from the older individuals after PEMF treatment (Figure 6).

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.006.jpg

PEMF stimulated expression of miR21-5p in differentiated human osteoblasts. Total RNAs from control or PEMF-treated hBMSCs of females (24 × 2, 27, 29, and 30 years old, n = 5) at day 23 of differentiation or (31, 36, 58, and 68 years old) at day 23 or 33 of differentiation were isolated and subjected to RT-qPCR using the miScript II kit with miScript HiSpec Buffer and miScript SYBR Green PCR Kit. snoR10-1 was used to normalize miR21-5p expression and the expression is shown as a percentage of the relevant control samples. ?indicates significant increase compared to control using one-way ANOVA.

3.7. PEMF and miR21-5p Stimulation of Osteoblast Differentiation Marker Gene Expression

It is evident that PEMF stimulated miR21-5p expression in differentiated osteoblasts from younger individuals (Figure 6) which strongly suggested a role for miR21-5p in promotion of osteoblast differentiation. To determine this role, hBMSCs were transiently transfected with negative control miRNA or miR21-5p mimic for 3 days and concurrently subjected to 4?h PEMF treatment every day for 6 days. Total RNA was isolated and subjected to RT-qPCR analysis. When cells were treated with PEMF, there was significantly increased ALP mRNA expression. The miR21-5p mimic alone had no effect but together with PEMF treatment caused a significant increase in ALP mRNA expression compared with PEMF treatment alone (Figure 7(a)). With type I collagen mRNA expression, no significant effect was seen with respect to PEMF, miR21-5p mimic, or both treatments under these conditions (Figure 7(b)).

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.007.jpg

PEMF resulted in stimulation of expression of ALP mRNA and its effect was further enhanced by miR21-5p. Human BMSCs from a 31-year-old female were transiently transfected with 50?nM of negative control miRNA or miR-21-5p mimic for 72?h in osteogenic medium and PEMF treatment was carried out for 4?h each day for a total of 6 days. Total RNA was isolated and RT-qPCR was carried out using the primers for ALP (a) and collagen 1A1 (b) genes. Expression of the mRNAs is shown relative to the RPL13 gene. n = 3. ?? indicates significant increase compared to negative control miRNA transfection. # indicates significant increase compared to all treatments. Analysis by one-way ANOVA.

3.8. PEMF Regulation of Smad7 via miR21-5p in Differentiating Osteoblasts

In silico analysis (http://www.microrna.org/microrna/home.do) was used to identify the putative target genes of miR21-5p for its functional importance towards osteogenic commitment. Among them some antagonistic effectors of osteogenesis such as Smad7, Smurf1, and Crim1 were found. The 3?UTR regions of Smad7, Smurf1, and Crim1 held at least 6-nt perfect complementarities to the miR21-5p seed region (Figure 8(a)). To validate these putative target genes of miR21-5p, hBMSCs were transiently transfected with either negative control miRNA or miR21-5p inhibitor and concurrently treated with PEMF for 4?h each day for 3 days. To determine the expression level of these target genes, total RNA was isolated, followed by RT-qPCR analysis. There was no significant change in mRNA expression of Smurf2 (Figure 8(b)) and Crim1 (Figure 8(c)) in the cells in the presence of PEMF treatment, miR21-5p inhibitor, or both. In the case of Smad7, there was a significant decrease in its mRNA expression after PEMF treatment, and inclusion of miR21-5p inhibitor reversed the PEMF effect resulting in increased Smad7 mRNA expression (Figure 8(d)). From these results we suggest that Smad7, an antagonist of TGF-?signaling, is likely to be miR21-5p’s target gene and PEMF downregulates its mRNA expression via miR21-5p in differentiating osteoblasts. In fact, at least two groups have shown that the 3?-UTR of Smad7 is, indeed, a target for miR21-5p, resulting in a decrease in Smad7 protein levels [].

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.008.jpg

Putative target genes of miR21-5p and PEMF decreases Smad7 mRNA through miR21-5p. (a) The putative target region analysis was performed for Smurf2, Crim1, and Smad7 mRNAs 3? UTR by miR21-5p seed sequence. ((b)–(d)) Human BMSCs from a 27-year-old female were transiently transfected with 50?nM of negative control miRNA or miR21-5p inhibitor for 72?h in osteogenic medium and PEMF treatment was carried out concurrently for 4?h each day for 3 days. Total RNA was isolated and RT-qPCR was carried out using the primers for (a) Smurf2, (b) Crim1, and (c) Smad7 genes. Expression of mRNAs is shown relative to that of the RPL13 gene. n = 3. ? indicates significant increase compared to negative control miRNA transfection or PEMF treatment with negative control miRNA transfection. # indicates significant decrease compared to PEMF treatment with miR21-5p inhibitor transfection. Analysis by one-way ANOVA.

3.9. PEMF Regulation of Runx2 Expression via miR21-5p and Smad7 in Differentiating Osteoblasts

Since Runx2 is required for osteoblast differentiation and PEMF stimulated expression of osteoblast differentiation marker genes (Figure 3), we next examined the PEMF stimulation of expression of Runx2 in differentiating hBMSCs and the role played by miR21-5p. Human BMSCs were transiently transfected with either negative control miRNA or miR-21-5p inhibitor, followed by PEMF treatment. Total RNA was isolated and subjected to RT-qPCR analysis. The result showed that there was a significant increase in expression of Runx2 mRNA in response to PEMF treatment and this effect was blocked by miR21-5p inhibitor in differentiating osteoblasts (Figure 9). From these results, we suggest that PEMF promotes its osteogenic effect via stimulation of miR21-5p expression and activation of TGF-? signaling in hBMSCs. A figure summarizing that the mechanisms we conclude are involved in PEMF stimulation of BMSCs and osteoblast differentiation is shown in Figure 10.

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.009.jpg

PEMF stimulated Runx2 expression and its effect was downregulated by miR21-5p inhibitor. Human BMSCs from a 27-year-old female were transiently transfected with 50?nM of negative control miRNA or miR21-5p inhibitor for 3 days in osteogenic medium and PEMF treatment was carried out concurrently for 4?h each day for 3 days. Total RNA was isolated and RT-qPCR was carried out using the primers for Runx2. Expression of Runx2 mRNA is shown relative to that of the RPL13 gene. n = 3. ? indicates significant decrease compared to negative control miRNA transfection or PEMF treatment with negative control miRNA transfection. # indicates significant increase compared to control treatment with negative control miRNA transfection. Analysis by one-way ANOVA.

An external file that holds a picture, illustration, etc. Object name is SCI2017-2450327.010.jpg

Schema of the mechanisms involved in PEMF stimulation of BMSC proliferation and osteoblast differentiation. The magnetic field (B) is thought to elicit Eddy Currents that act on BMSCs and cause activation of ERKs that are then involved in increased BMSC proliferation. After the BMSCs reach confluence and they are switched to differentiation medium, the magnetic field (B) and the resultant Eddy Currents cause a decrease in fibrillin 2 expression and an increase in TGF-?2 and miR21-5p expression. The decrease in fibrillin 2 would lead to an increase in the amount of available TGF-?2. The increase in miR21-5p appears to cause a decrease in inhibitory Smad7 expression, thus, enhancing TGF-?2 activation of Smad2 with resulting increase in Runx2, collagen I, and alkaline phosphatase expression in the cultures, that is, increased osteoblast differentiation.

4. Discussion

Numerous studies have shown that mechanical stimulation of bone progenitors including ultrasound [], mechanical strain [], and compression as well as shear forces has a stimulatory effect on bone progenitors involved in bone healing of critical size defects and nonunions in vivo. A broad set of investigations has aimed to unravel potential underlying molecular mechanisms and growth factor pathways involved with sophisticated in vitro methods []. A number of mechanisms have been proposed by which mechanical cues on different physical scales and identities can incorporate into growth factor signaling []. In particular, the major TGF-? growth factor superfamily of ligands (including TGF-? 1 and 2 as well as BMPs) and their downstream signaling via Smad2/3 and Smad1/5/8 transcription factors, respectively [], appears to be affected by mechanical stimulation in a diverse set of cells, with the majority of research focussing on bone progenitors, for example, BMSCs, osteoblasts, osteocytes, and chondrocytes. This is a large and ongoing field of study.

The molecular mechanisms responsible for the effect of PEMF on bone formation [] have not been completely elucidated. We found that PEMF promoted preosteoblast proliferation from hBMSCs from individuals up to age 30, but not older individuals, and stimulated differentiation marker gene expression of mineralizing hBMSCs of all ages. To dissect the mechanisms, PEMF effects on proliferation, differentiation, and mineralization of hBMSCs were examined by Affymetrix microarray analyses. We found that PEMF stimulation of hBMSC proliferation mainly affected genes of cell cycle regulation, cell structure, ECM, and some growth receptors or kinase pathways (Table 2). At the cellular and molecular levels, PEMF has been reported to promote the synthesis of ECM proteins and exert a direct effect on the production of proteins that regulate gene transcription. PEMF may affect several membrane receptors and stimulate osteoblasts to secrete several growth factors such as BMP-2 and BMP-4 and TGF-?. PEMF has been reported to affect osteoblast cellular proliferation and differentiation of bone cells in vitro by enhancing DNA synthesis [], increasing the expression of bone marker genes during differentiation and mineralization [], and enhancing calcified matrix production. Several experimental studies also demonstrated that PEMF stimulation could potently promote osteogenesis and enhance bone mineralization both in vivo and in vitro [].

The microarray data for PEMF regulation of differentiation and mineralization of hBMSCs showed regulation of transcriptional regulators, metabolism, proteases, cytokines and growth factors, and also cell adhesion and binding proteins and cytoskeletal and structural proteins (Tables ?(Tables33 and ?and4).4). Identifying the signaling pathways and their associated regulatory mechanisms of PEMF action on osteogenesis might further promote its use in clinical applications. Thus, PEMF regulated preosteoblast gene expression during the differentiation and mineralization stages, and candidate genes chosen from microarray analyses were confirmed by RT-qPCR (Tables ?(Tables55 and ?and6).6). Notably, the TGF-? signaling pathway and miR21 seem to be most highly regulated by PEMF. Thus, in the present study, we systematically investigated the mechanism of action of PEMF effects on osteogenesis via activation of TGF-? signaling and miR21-5p expression using hBMSCs.

The TGF-?/BMP signaling pathway plays a fundamental role in the regulation of bone organogenesis through the activation of receptor serine/threonine kinases. Perturbations of TGF-?/BMP activity are almost invariably linked to a wide variety of clinical outcomes including skeletal anomalies []. Phosphorylation of TGF-? (I/II) or BMP receptors activates intracellular downstream Smads, the transducer of TGF-?/BMP signals. In our studies, PEMF (Cervical-Stim) treatment activated only the Smad2 signaling component in differentiated hBMSCs (Figure 4) and activation of this signaling pathway appeared to be essential for PEMF stimulation of early osteoblast differentiation marker genes such as ALP and type I collagen (Figure 5). It is notable that it did not appear to activate the BMP pathway through Smad1/5/8 phosphorylation. The TGF-?/BMP signaling effect may be complex and highly time- and space-specific during skeletal development and bone formation. Very recently, Xie et al. [] have described a different PEMF signal as operating through the BMP receptor on the primary cilium of rat calvarial osteoblasts in culture. Our accumulated data do not indicate that the BMP pathway is involved in the signaling mechanism of either Spinal-Stim or Cervical-Stim but we cannot rule out that it may have a role if investigated further. This signaling cascade can be modulated by various factors and other pathways []. Activation of Wnt/Lrp5/?-catenin or calcium-related mechanisms by PEMF treatment for osteogenic activity have also been reported [].

Osteoblast differentiation is tightly controlled by several regulators including miRNAs [] that can regulate expression of genes during differentiation of MSCs towards osteoblasts, resulting in the osteogenic lineage. Differential expression of miRNAs could be responsible for activation of several signaling pathways such as TGF-?/BMP, Wnt/?-catenin, and transcription factors []. PEMF stimulated miR21-5p expression in differentiated hBMSCs from younger females (Figure 6) suggesting one of the ways PEMF mediates its osteogenic effect on these cells is via miR21-5p. MicroRNA 21 was one of the first miRNAs detected in the human genome and it was found to be overexpressed in several types of cancer tissues []. A role for miR21 in cell proliferation and apoptosis has been reported []. With regard to the regulation of bone formation, a number of miRNAs are expressed in the developing skeletal system and miRNA-dependent modulation of gene function can alter skeletal phenotypes across individuals and also within the same individual over time []. MicroRNAs might have direct or indirect effects for their regulatory functions in osteoblast differentiation.

To study the functional role of miR21-5p during osteoblast differentiation by PEMF treatment, it was necessary to alter its endogenous expression/activity. Overexpression of miR21-5p (mimic) in differentiated hBMSCs had no effect on mRNA expression of ALP and type I collagen (Figure 7) but required PEMF to have an enhanced effect on ALP mRNA expression which suggests that PEMF could also involve other pathways and molecules in addition to miR21-5p for its osteogenic effects in these cells. The putative targets of miR21-5p can be classified according to their negative contribution in osteogenic differentiation or positive contribution to other lineages using online software. Among them are some key regulators or antagonistic effectors of osteogenesis such as Smad7, Smurf2, and Crim1 and these genes are well documented in their antagonistic roles in osteogenesis []. Expression of the putative target genes in the presence of the miR21-5p inhibitor showed a significant increase in Smad7 mRNA expression in differentiated hBMSCs (Figure 8). The inhibitory Smads (Smad6, Smad7) potentially act as suppressors of bone formation. While Smad7 inhibits TGF-?/BMP signaling, Smad6 is less effective in inhibiting TGF-?signaling. It has been reported that Smad7 can inhibit ALP activity and suppress type I collagen mRNA and protein levels []. MicroRNA 21 has been shown to be a key regulator of TGF-? signaling [] and Smad7 was found to be one of its target genes []. Other target genes such as PTEN and STAT3 have also been reported for miR21 []. Based on our results (Figures ?(Figures77 and ?and8),8), we suggest that Smad7 is a target gene for miR21-5p during PEMF regulation of osteoblast differentiation.

Since PEMF stimulates miR21-5p expression in differentiated hBMSCs (Figure 6) and miR21-5p targets Smad7 (Figure 8(d)), the PEMF action on osteogenesis via miR21-5p and Smad7 was further investigated. Runx2 is essential for the commitment of multipotent mesenchymal cells to the osteoblastic lineage. In general, Runx2 activity can be altered by its interacting proteins and/or posttranslational modifications []. The steady-state protein level of Runx2 can be regulated by E3 ubiquitin ligases, Smurf1 and Smurf2, and it has been reported that the degradation of endogenous Runx2 can be blocked by a proteasomal inhibitor or by Smurf2 siRNA []. PEMF stimulated Runx2 mRNA in differentiated hBMSCs, and miR21-5p inhibitor prevented the PEMF stimulation of Runx2 expression (Figure 9). It has already been reported that Smad7 interacts with Smurf2 but it does not interact with Runx2 []. Hence, targeting Smad7 through miR21-5p by PEMF could possibly decrease the Smad7-dependent Smurf2 activity, resulting in stabilization of Runx2 protein, and feedback to increased transcription of Runx2 in differentiated hBMSCs. A figure summarizing that the mechanisms we conclude are involved in PEMF stimulation of BMSCs and osteoblast differentiation is shown in Figure 10. We can only speculate as to how PEMF regulates miR21-5p, but others have shown that this microRNA is regulated by transcriptional mechanisms, such as by myocardin-related transcription factor-A (58) or by STAT3 (59), and such mechanisms could possibly be implicated in PEMF’s actions.

5. Conclusions

Our results show that PEMF significantly stimulated the cell number of preosteoblasts from BMSCs of young women while not stimulating those from women older than 30. We also showed that PEMF regulates a range of genes in hBMSCs to stimulate their proliferation, differentiation, and mineralization. Our further investigation suggests a novel regulatory mechanism of PEMF action during differentiation and mineralization of hBMSCs by activation of the TGF-? signaling pathway. PEMF appears to activate this pathway in hBMSCs of younger women by inhibiting Smad7 expression through miR21-5p and in turn PEMF controls the function of Runx2 resulting in promotion of its osteogenic effect.

Acknowledgments

This work was supported by a research contract to Dr. Partridge from Orthofix, Inc., Lewisville, TX, USA. Dr. Partridge also received honoraria and travel support from Orthofix, Inc. Dr. Selvamurugan and Mr. He received travel support from Orthofix, Inc. Drs. Rifkin and Dabovic received a subcontract from Dr. Partridge’s Orthofix research contract. Drs. James T. Ryaby, Nianli Zhang, and Erik I. Waldorff of Orthofix, Inc., critically reviewed the paper.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors’ Contributions

Nagarajan Selvamurugan and Zhiming He contributed equally to the work; Nagarajan Selvamurugan drafted the paper; Nagarajan Selvamurugan, Zhiming He, Daniel Rifkin, and Branka Dabovic contributed to the research design, acquisition, analysis, and interpretation of data; Nicola C. Partridge designed the research, contributed to the analysis and interpretation of the data, and critically revised the paper. All authors have read and approved the final submitted manuscript.

References

1. Victoria G., Petrisor B., Drew B., Dick D. Bone stimulation for fracture healing: what?s all the fuss? Indian Journal of Orthopaedics2009;43(2):117–120. doi: 10.4103/0019-5413.50844. [PMC free article][PubMed] [Cross Ref]
2. Kooistra B. W., Jain A., Hanson B. Electrical stimulation: nonunions. Indian Journal of Orthopaedics2009;43(2):149–155. doi: 10.4103/0019-5413.50849. [PMC free article] [PubMed] [Cross Ref]
3. Garland D. E., Moses B., Salyer W. Long-term follow-up of fracture nonunions treated with PEMFs. Contemporary Orthopaedics1991;22(3):295–302. [PubMed]
4. Linovitz R. J., Pathria M., Bernhardt M., et al. Combined magnetic fields accelerate and increase spine fusion: a double-blind, randomized, placebo controlled study. Spine2002;27(13):1383–1389. doi: 10.1097/00007632-200207010-00002. [PubMed] [Cross Ref]
5. Mooney V. A randomized double-blind prospective study of the efficacy of pulsed electromagnetic fields for interbody lumbar fusions. Spine1990;15(7):708–712. doi: 10.1097/00007632-199007000-00016.[PubMed] [Cross Ref]
6. Bodamyali T., Bhatt B., Hughes F. J., et al. Pulsed electromagnetic fields simultaneously induce osteogenesis and upregulate transcription of bone morphogenetic proteins 2 and 4 in rat osteoblasts in vitro. Biochemical and Biophysical Research Communications1998;250(2):458–461. doi: 10.1006/bbrc.1998.9243. [PubMed] [Cross Ref]
7. Selvamurugan N., Kwok S., Vasilov A., Jefcoat S. C., Partridge N. C. Effects of BMP-2 and pulsed electromagnetic field (PEMF) on rat primary osteoblastic cell proliferation and gene expression. Journal of Orthopaedic Research2007;25(9):1213–1220. doi: 10.1002/jor.20409. [PubMed] [Cross Ref]
8. Partridge N. C., He Z., Selvamurugan N. Microarray analysis of pulsed electromagnetic field (PEMF) stimulatory effects on human bone marrow stromal cells. Journal of Bone and Mineral Research2014;29(supplement 1):p. 432.
9. Aaron R. K., Ciombor D. M., Simon B. J. Treatment of nonunions with electric and electromagnetic fields. Clinical Orthopaedics and Related Research2004;(419):21–29. [PubMed]
10. Ciombor D. M., Aaron R. K. The role of electrical stimulation in bone repair. Foot and Ankle Clinics2005;10(4):579–593. doi: 10.1016/j.fcl.2005.06.006. [PubMed] [Cross Ref]
11. Kuzyk P. R. T., Schemitsch E. H. The science of electrical stimulation therapy for fracture healing. Indian Journal of Orthopaedics2009;43(2):127–131. doi: 10.4103/0019-5413.50846. [PMC free article][PubMed] [Cross Ref]
12. Fitzsimmons R. J., Ryaby J. T., Magee F. P., Baylink D. J. Combined magnetic fields increased net calcium flux in bone cells. Calcified Tissue International1994;55(5):376–380. doi: 10.1007/BF00299318.[PubMed] [Cross Ref]
13. Pavalko F. M., Norvell S. M., Burr D. B., Turner C. H., Duncan R. L., Bidwell J. P. A model for mechanotransduction in bone cells: the load-bearing mechanosomes. Journal of Cellular Biochemistry2003;88(1):104–112. doi: 10.1002/jcb.10284. [PubMed] [Cross Ref]
14. Tsai M.-T., Chang W. H.-S., Chang K., Hou R.-J., Wu T.-W. Pulsed electromagnetic fields affect osteoblast proliferation and differentiation in bone tissue engineering. Bioelectromagnetics2007;28(7):519–528. doi: 10.1002/bem.20336. [PubMed] [Cross Ref]
15. Ceccarelli G., Bloise N., Mantelli M., et al. A comparative analysis of the in vitro effects of pulsed electromagnetic field treatment on osteogenic differentiation of two different mesenchymal cell lineages. BioResearch Open Access2013;2(4):283–294. doi: 10.1089/biores.2013.0016. [PMC free article][PubMed] [Cross Ref]
16. Foley K. T., Mroz T. E., Arnold P. M., et al. Randomized, prospective, and controlled clinical trial of pulsed electromagnetic field stimulation for cervical fusion. Spine Journal2008;8(3):436–442. doi: 10.1016/j.spinee.2007.06.006. [PubMed] [Cross Ref]
17. Vimalraj S., Partridge N. C., Selvamurugan N. A positive role of microRNA-15b on regulation of osteoblast differentiation. Journal of Cellular Physiology2014;229(9):1236–1244. doi: 10.1002/jcp.24557. [PMC free article] [PubMed] [Cross Ref]
18. Xie Y. F., Shi W. G., Zhou J., et al. Pulsed electromagnetic fields stimulate osteogenic differentiation and maturation of osteoblasts by upregulating the expression of BMPRII localized at the base of primary cilium. Bone2016;93:22–32. doi: 10.1016/j.bone.2016.09.008. [PubMed] [Cross Ref]
19. Wrighton K. H., Lin X., Yu P. B., Feng X.-H. Transforming growth factor ? can stimulate Smad1 phosphorylation independently of bone morphogenic protein receptors. Journal of Biological Chemistry2009;284(15):9755–9763. doi: 10.1074/jbc.m809223200. [PMC free article] [PubMed] [Cross Ref]
20. Daly A. C., Randall R. A., Hill C. S. Transforming growth factor ?-induced Smad1/5 phosphorylation in epithelial cells is mediated by novel receptor complexes and is essential for anchorage-independent growth. Molecular and Cellular Biology2008;28(22):6889–6902. doi: 10.1128/MCB.01192-08.[PMC free article] [PubMed] [Cross Ref]
21. Lin L., Gan H., Zhang H., et al. MicroRNA-21 inhibits SMAD7 expression through a target sequence in the 3? untranslated region and inhibits proliferation of renal tubular epithelial cells. Molecular Medicine Reports2014;10(2):707–712. doi: 10.3892/mmr.2014.2312. [PubMed] [Cross Ref]
22. Li Q., Zhang D., Wang Y., et al. MiR-21/Smad 7 signaling determines TGF-?1-induced CAF formation. Scientific Reports2013;3, article 2038 doi: 10.1038/srep02038. [PMC free article] [PubMed][Cross Ref]
23. Padilla F., Puts R., Vico L., Guignandon A., Raum K. Stimulation of bone repair with ultrasound. Advances in Experimental Medicine and Biology2016;880:385–427. doi: 10.1007/978-3-319-22536-4_21.[PubMed] [Cross Ref]
24. Chen J. C., Hoey D. A., Chua M., Bellon R., Jacobs C. R. Mechanical signals promote osteogenic fate through a primary cilia-mediated mechanism. FASEB Journal2016;30(4):1504–1511. doi: 10.1096/fj.15-276402. [PMC free article] [PubMed] [Cross Ref]
25. Rosa N., Simoes R., Magalhães F. D., Marques A. T. From mechanical stimulus to bone formation: a review. Medical Engineering and Physics2015;37(8):719–728. doi: 10.1016/j.medengphy.2015.05.015.[PubMed] [Cross Ref]
26. Gao J., Fu S., Zeng Z., et al. Cyclic stretch promotes osteogenesis-related gene expression in osteoblast-like cells through a cofilin-associated mechanism. Molecular Medicine Reports2016;14(1):218–224. doi: 10.3892/mmr.2016.5239. [PMC free article] [PubMed] [Cross Ref]
27. Deng M., Liu P., Xiao H., et al. Improving the osteogenic efficacy of BMP2 with mechano growth factor by regulating the signaling events in BMP pathway. Cell and Tissue Research2015;361(3):723–731. doi: 10.1007/s00441-015-2154-3. [PubMed] [Cross Ref]
28. Rahman M. S., Akhtar N., Jamil H. M., Banik R. S., Asaduzzaman S. M. TGF-?/BMP signaling and other molecular events: regulation of osteoblastogenesis and bone formation. Bone Research2015;3 doi: 10.1038/boneres.2015.5.15005 [PMC free article] [PubMed] [Cross Ref]
29. Chen G., Deng C., Li Y.-P. TGF-? and BMP signaling in osteoblast differentiation and bone formation. International Journal of Biological Sciences2012;8(2):272–288. doi: 10.7150/ijbs.2929.[PMC free article] [PubMed] [Cross Ref]
30. Fu Y.-C., Lin C.-C., Chang J.-K., et al. A novel single pulsed electromagnetic field stimulates osteogenesis of bone marrow mesenchymal stem cells and bone repair. PLOS ONE2014;9(3) doi: 10.1371/journal.pone.0091581.e91581 [PMC free article] [PubMed] [Cross Ref]
31. De Mattei M., Caruso A., Traina G. C., Pezzetti F., Baroni T., Sollazzo V. Correlation between pulsed electromagnetic fields exposure time and cell proliferation increase in human osteosarcoma cell lines and human normal osteoblast cells in vitro. Bioelectromagnetics1999;20(3):177–182. [PubMed]
32. Chang K., Chang W. H.-S. Pulsed electromagnetic fields prevent osteoporosis in an ovariectomized female rat model: a prostaglandin E2-associated process. Bioelectromagnetics2003;24(3):189–198. doi: 10.1002/bem.10078. [PubMed] [Cross Ref]
33. Jing D., Cai J., Shen G., et al. The preventive effects of pulsed electromagnetic fields on diabetic bone loss in streptozotocin-treated rats. Osteoporosis International2011;22(6):1885–1895. doi: 10.1007/s00198-010-1447-3. [PubMed] [Cross Ref]
34. Jing D., Shen G., Huang J., et al. Circadian rhythm affects the preventive role of pulsed electromagnetic fields on ovariectomy-induced osteoporosis in rats. Bone2010;46(2):487–495. doi: 10.1016/j.bone.2009.09.021. [PubMed] [Cross Ref]
35. Guo L., Zhao R. C. H., Wu Y. The role of microRNAs in self-renewal and differentiation of mesenchymal stem cells. Experimental Hematology2011;39(6):608–616. doi: 10.1016/j.exphem.2011.01.011. [PubMed] [Cross Ref]
36. Pan A., Chang L., Nguyen A., James A. W. A review of hedgehog signaling in cranial bone development. Frontiers in Physiology2013;4, article 61 doi: 10.3389/fphys.2013.00061.[PMC free article] [PubMed] [Cross Ref]
37. Jing D., Li F., Jiang M., et al. Pulsed electromagnetic fields improve bone microstructure and strength in ovariectomized rats through a Wnt/Lrp5/?-catenin signaling-associated mechanism. PLoS ONE2013;8(11) doi: 10.1371/journal.pone.0079377.e79377 [PMC free article] [PubMed] [Cross Ref]
38. Petecchia L., Sbrana F., Utzeri R., et al. Electro-magnetic field promotes osteogenic differentiation of BM-hMSCs through a selective action on Ca2+-related mechanisms. Scientific Reports2015;5, article 13856 doi: 10.1038/srep13856. [PMC free article] [PubMed] [Cross Ref]
39. Vimalraj S., Selvamurugan N. MicroRNAs expression and their regulatory networks during mesenchymal stem cells differentiation toward osteoblasts. International Journal of Biological Macromolecules2014;66:194–202. doi: 10.1016/j.ijbiomac.2014.02.030. [PubMed] [Cross Ref]
40. Li H., Yang F., Wang Z., Fu Q., Liang A. MicroRNA-21 promotes osteogenic differentiation by targeting small mothers against decapentaplegic 7. Molecular Medicine Reports2015;12(1):1561–1567. doi: 10.3892/mmr.2015.3497. [PubMed] [Cross Ref]
41. Schramke V., Allshire R. Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science2003;301(5636):1069–1074. doi: 10.1126/science.1086870. [PubMed] [Cross Ref]
42. Ono M., Yamada K., Avolio F., Afzal V., Bensaddek D., Lamond A. I. Targeted knock-down of miR21 primary transcripts using snoMEN vectors induces apoptosis in human cancer cell lines. PLoS ONE2015;10(9) doi: 10.1371/journal.pone.0138668.e0138668 [PMC free article] [PubMed] [Cross Ref]
43. Jiao G., Pan B., Zhou Z., Zhou L., Li Z., Zhang Z. MicroRNA-21 regulates cell proliferation and apoptosis in H2O2-stimulated rat spinal cord neurons. Molecular Medicine Reports2015;12(5):7011–7016. doi: 10.3892/mmr.2015.4265. [PubMed] [Cross Ref]
44. He X., Eberhart J. K., Postlethwait J. H. MicroRNAs and micromanaging the skeleton in disease, development and evolution. Journal of Cellular and Molecular Medicine2009;13(4):606–618. doi: 10.1111/j.1582-4934.2009.00696.x. [PMC free article] [PubMed] [Cross Ref]
45. He L., Yang N., Isales C. M., Shi X.-M. Glucocorticoid-induced leucine zipper (GILZ) antagonizes TNF-? inhibition of mesenchymal stem cell osteogenic differentiation. PLoS ONE2012;7(3) doi: 10.1371/journal.pone.0031717.e31717 [PMC free article] [PubMed] [Cross Ref]
46. Yano M., Inoue Y., Tobimatsu T., et al. Smad7 inhibits differentiation and mineralization of mouse osteoblastic cells. Endocrine Journal2012;59(8):653–662. doi: 10.1507/endocrj.EJ12-0022. [PubMed][Cross Ref]
47. Jeong Kim Y., Jin Hwang S., Chan Bae Y., Sup Jung J. MiR-21 regulates adipogenic differentiation through the modulation of TGF-? signaling in mesenchymal stem cells derived from human adipose tissue. Stem Cells2009;27(12):3093–3102. doi: 10.1002/stem.235. [PubMed] [Cross Ref]
48. Zhang B. G., Li J. F., Yu B. Q., Zhu Z. G., Liu B. Y., Yan M. microRNA-21 promotes tumor proliferation and invasion in gastric cancer by targeting PTEN. Oncology Reports2012;27(4):1019–1026. doi: 10.3892/or.2012.1645. [PMC free article] [PubMed] [Cross Ref]
49. Kim Y. J., Hwang S. H., Cho H. H., Shin K. K., Bae Y. C., Jung J. S. MicroRNA 21 regulates the proliferation of human adipose tissue-derived mesenchymal stem cells and high-fat diet-induced obesity alters microRNA 21 expression in white adipose tissues. Journal of Cellular Physiology2012;227(1):183–193. doi: 10.1002/jcp.22716. [PubMed] [Cross Ref]
50. Jonason J. H., Xiao G., Zhang M., Xing L., Chen D. Post-translational regulation of Runx2 in bone and cartilage. Journal of Dental Research2009;88(8):693–703. doi: 10.1177/0022034509341629.[PMC free article] [PubMed] [Cross Ref]
51. Selvamurugan N., Shimizu E., Lee M., Liu T., Li H., Partridge N. C. Identification and characterization of Runx2 phosphorylation sites involved in matrix metalloproteinase-13 promoter activation. FEBS Letters2009;583(7):1141–1146. doi: 10.1016/j.febslet.2009.02.040. [PMC free article] [PubMed] [Cross Ref]
52. Choi Y. H., Kim Y.-J., Jeong H. M., Jin Y.-H., Yeo C.-Y., Lee K. Y. Akt enhances Runx2 protein stability by regulating Smurf2 function during osteoblast differentiation. FEBS Journal2014;281(16):3656–3666. doi: 10.1111/febs.12887. [PubMed] [Cross Ref]
53. Ge C., Cawthorn W. P., Li Y., Zhao G., Macdougald O. A., Franceschi R. T. Reciprocal control of osteogenic and adipogenic differentiation by ERK/MAP kinase phosphorylation of Runx2 and PPAR?transcription factors. Journal of Cellular Physiology2016;231(3):587–596. doi: 10.1002/jcp.25102.[PMC free article] [PubMed] [Cross Ref]
54. Wang C. Y., Yang S. F., Wang Z., et al. PCAF acetylates Runx2 and promotes osteoblast differentiation. Journal of Bone and Mineral Metabolism2013;31(4):381–389. doi: 10.1007/s00774-013-0428-y.[PubMed] [Cross Ref]
55. Vishal M., Ajeetha R., Keerthana R., Selvamurugan N. Regulation of Runx2 by histone deacetylases in bone. Current Protein & Peptide Science2016;17(4):343–351. doi: 10.2174/1389203716666150623104017. [PubMed] [Cross Ref]
56. Kaneki H., Guo R., Chen D., et al. Tumor necrosis factor promotes Runx2 degradation through up-regulation of Smurf1 and Smurf2 in osteoblasts. Journal of Biological Chemistry2006;281(7):4326–4333. doi: 10.1074/jbc.M509430200. [PMC free article] [PubMed] [Cross Ref]

Veterinary

Res Vet Sci. 2018 May 7;119:1-8. doi: 10.1016/j.rvsc.2018.05.005. [Epub ahead of print]

Veterinary applications of pulsed electromagnetic field therapy.

Gaynor JS1, Hagberg S2, Gurfein BT3.

Author information

1
Peak Performance Veterinary Group, 5520 N Nevada Ave, Colorado Springs, CO 80918, USA. Electronic address: jgaynor@nopetpain.com.
2
Department of Neurosurgery, University of New Mexico School of Medicine, MSC 10 5615, Albuquerque, NM 87131, USA. Electronic address: shagberg@unm.edu.
3
Division of Experimental Medicine, University of California San Francisco, 1001 Potrero Ave, San Francisco, CA 94110, USA. Electronic address: Blake.Gurfein@ucsf.edu.

Abstract

Pulsed electromagnetic field (PEMF) therapy can non-invasively treat a variety of pathologies by delivering electric and magnetic fields to tissues via inductive coils. The electromagnetic fields generated by these devices have been found to affect a variety of biological processes and basic science understanding of the underlying mechanisms of action of PEMF treatment has accelerated in the last 10?years. Accumulating clinical evidence supports the use of PEMF therapy in both animals and humans for specific clinical indications including bone healing, wound healing, osteoarthritis and inflammation, and treatment of post-operative pain and edema. While there is some confusion about PEMF as a clinical treatment modality, it is increasingly being prescribed by veterinarians. In an effort to unravel the confusion surrounding PEMF devices, this article reviews important PEMF history, device taxonomy, mechanisms of action, basic science and clinical evidence, and relevant trends in veterinary medicine. The data reviewed underscore the usefulness of PEMF treatment as a safe, non-invasive treatment modality that has the potential to become an important stand-alone or adjunctive treatment modality in veterinary care.

KEYWORDS:

Bone growth stimulator; Edema; Inflammation; Medical devices; Post-operative pain; Pulsed electromagnetic field

Clin Tech Small Anim Pract. 2007 Nov;22(4):160-5. doi: 10.1053/j.ctsap.2007.09.004.

Select modalities.

Canapp DA1.

Author information

1
Veterinary Orthopedic and Sports Medicine Group, Ellicott City, MD 21042, USA. dcanapp@vetsportsmedicine.com

Abstract

Physical rehabilitation modalities such as therapeutic ultrasound (TU), transcutaneous electrical neuromuscular stimulation (TENS), neuromuscular electrical stimulation (NMES), cold or low-level laser therapy (LLLT), and pulsed magnetic field therapy (PMF) can all, when used properly, assist in treating orthopedic injuries, neurological conditions, and chronic conditions brought about by normal aging in our small animal companions. TU uses sound waves to produce both thermal and nonthermal effects that aid in tissue healing, repair, and function. TENS uses different frequencies of electrical current to decrease pain and inflammation. NMES also uses an electrical current to stimulate muscle contraction to assist in normal neuromuscular function in postorthopedic and neurological injuries. LLLT uses light energy to reduce pain, decrease inflammation, and stimulate healing at a cellular level. PMF uses magnetic field to stimulate normal cellular ion exchange and oxygen utilization and promote generalized healing of tissues. These modalities are discussed in detail covering mechanism of action, parameters, settings, and indications/contraindications of use in our small animals. Although these modalities are important in the physical rehabilitation of small animals, they need to be incorporated with a proper diagnosis, manual therapy, and home exercise program into a specific and individualized patient treatment protocol.

J Orthop Res. 2002 Sep;20(5):1106-14.

Effect of pulsed electromagnetic fields (PEMF) on late-phase osteotomy gap healing in a canine tibial model.

Inoue N1, Ohnishi I, Chen D, Deitz LW, Schwardt JD, Chao EY.

Author information

1
Department of Orthopaedic Surgery, The Johns Hopkins University, Baltimore, MD 21205-2196, USA.

Abstract

The effects of a pulsed electromagnetic field (PEMF) on late bone healing phases using an osteotomy gap model in the canine mid-tibia were investigated. A transverse mid-diaphyseal tibial osteotomy with a 2-mm gap was performed unilaterally in 12 adult mixed-breed dogs and stabilized with external fixation. Animals in the variable group (n = 6) were treated with PEMF for 1 h daily starting 4 weeks after surgery for a total of 8 weeks, whereas no stimulation signal was generated in the control group (n = 6). Functional load-bearing and radiographic assessments were conducted time-sequentially until euthanasia 12 weeks after surgery. Torsional tests and an analysis of undecalcified histology were performed on the retrieved mid-tibial diaphysis containing the osteotomy site. In the PEMF group, load-bearing of the operated limb recovered earlier when compared to the control group (p < 0.05). Load-bearing in the PEMF group at 8 weeks was greater than in the control group (p < 0.02). The periosteal callus area increased following surgery at 6 weeks (p < 0.05) and thereafter (p < 0.01) in the PEMF group, while a significant increase was observed at 8 and 10 weeks after surgery (p < 0.05) in the control group. Both the normalized maximum torque and torsional stiffness of the PEMF group were significantly greater than those of the control group (p < 0.04 and p < 0.007, respectively). Histomorphometric analyses revealed greater new-bone formation (p < 0.05) in the osteotomy gap tissue and increased mineral apposition rate (p < 0.04) and decreased porosity in the cortex adjacent to the osteotomy line (p < 0.02) in the PEMF group. PEMF stimulation of 1 h per day for 8 weeks provided faster recovery of load-bearing, a significant increase in new bone formation, and a higher mechanical strength of the healing mid-tibial osteotomy. This study revealed enhancing effects of PEMF on callus formation and maturation in the late-phase of bone healing.

PMID:
12382979
DOI:
10.1016/S0736-0266(

Stellate Ganglion Treatment

Logo of scirep

About Editorial Board For Authors Scientific Reports
Sci Rep. 2016; 6: 30783.
Published online 2016 Jul 29. doi:  10.1038/srep30783
PMCID: PMC4965791
PMID: 27470078

Noninvasive low-frequency electromagnetic stimulation of the left stellate ganglion reduces myocardial infarction-induced ventricular arrhythmia

Songyun Wang,1,* Xiaoya Zhou,1,* Bing Huang,1 Zhuo Wang,1 Liping Zhou,1 Menglong Wang,1 Lilei Yu,a,1 andHong Jiangb,1
1Department of Cardiology, Renmin Hospital of Wuhan University, Cardiovascular Research Institute of Wuhan University, Wuhan, 430060, Hubei, China
*These authors contributed equally to this work.
Author information ? Article notes ? Copyright and License information ? Disclaimer
Received 2016 Jan 29; Accepted 2016 Jul 11.

Abstract

Noninvasive magnetic stimulation has been widely used in autonomic disorders in the past few decades, but few studies has been done in cardiac diseases. Recently, studies showed that low-frequency electromagnetic field (LF-EMF) might suppress atrial fibrillation by mediating the cardiac autonomic nervous system. In the present study, the effect of LF-EMF stimulation of left stellate ganglion (LSG) on LSG neural activity and ventricular arrhythmia has been studied in an acute myocardium infarction canine model. It is shown that LF-EMF stimulation leads to a reduction both in the neural activity of LSG and in the incidence of ventricular arrhythmia. The obtained results suggested that inhibition of the LSG neural activity might be the causal of the reduction of ventricular arrhythmia since previous studies have shown that LSG hyperactivity may facilitate the incidence of ventricular arrhythmia. LF-EMF stimulation might be a novel noninvasive substitute for the existing implant device-based electrical stimulation or sympathectomy in the treatment of cardiac disorders.

Previous studies have demonstrated that the activation and remodeling of left stellate ganglion (LSG) induced by myocardial infarction, might be the immediate triggering mechanisms of ventricular arrhythmia (VA) and sudden cardiac death,, and suppressing LSG neural activity might be a feasible antiarrhythmic therapy. In the past decades, LSG denervation and blocking have been shown to be benefit for reducing VA. However, undesirable side effects, such as cervical injury and Horner’s syndrome, have limited the clinic use of LSG denervation or blocking. Therefore, exploring a novel noninvasive approach is necessary.

Transcranial magnetic stimulation (TMS), a neurostimulation and neuromodulation technique based on the principle of electromagnetic induction of an electric field in the brain, has been proposed for treatment of a variety of neurological disorders. Previous studies has shown that TMS might mediate the cardiac rhythm by modulating the autonomic nervous system. Scherlag et al. showed that exposure the vagal trunks or the chest to the low-frequency magnetic field (LF-EMF) might suppress atrial fibrillation, whereas exposure to the high-frequency field might induce atrial fibrillation by autonomic modulating. Recently, Yu et al. further demonstrated that LF-EMF stimulation of the vagal trunks or chest might suppress atrial fibrillation by inhibiting the neural activity of atrial ganglionated plexus. In this study, we hypothesized that exposure LSG to the LF-EMF might inhibit the LSG neural activity, thereby reducing VAs after acute myocardial infarction.

Results

LSG was exposed to intermittent LF-EMF stimulation before left anterior descending artery occlusion in LF-EMF group (Fig. 1A–C). Both the blood pressure and heart rate were kept at a stable level during the LF-EMF stimulation. No visible damage was shown in LSG or cardiac tissue after 90?min LF-EMF treatment. All dogs developed ECG ST-segment and/or T-wave changes acutely after ligating the left anterior descending artery.

An external file that holds a picture, illustration, etc.
Object name is srep30783-f1.jpg

Schematic representation of the position of the LF-EMF (A), stimulus pattern (B) and the experimental design flow chart (C). LSG, left stellate ganglion; LF-EMF, low-frequency electromagnetic field; LAD, left anterior descending artery; MAP, monophasic action potential; HRV, heart rate variability; VA, ventricular arrhythmia.

Effect of LF-EMF stimulation on myocardial infarction-induced VAs

Figure 2A shows the representative examples of VAs in the Control group and LF-EMF group. As compared to the Control group, both the number of ventricular premature beat (VPB) and the number of non-sustained ventricular tachycardia (VT) were significantly decreased (Fig. 2B,C). Furthermore, the incidence of sustained VT/VF was significantly suppressed (75.0% vs 12.5%, P?<?0.05, Fig. 2D) in the LF-EMF group.

An external file that holds a picture, illustration, etc.
Object name is srep30783-f2.jpg

Representative examples (A) and the incidence (BE) of AMI-induced VAs in the Control group (n?=?8) and EMF group (n?=?8). *P?<?0.05 and **P?<?0.05 as compared to the Control group. AMI, acute myocardial infarction; VPB, ventricular premature beats; VT, ventricular tachycardia; VF, ventricular fibrillation; other abbreviations as in Fig. 1.

Effect of LF-EMF stimulation on MAP

Figure 3A–F demonstrates the effect of LF-EMF on action potential duration at 90% repolarization (APD90Fig. 3A–C), pacing cycle length of action potential duration alternans (PCL, Fig. 3D–F) and the maximal slope of the restitute curve (SmaxFig. 3G–I). As compared to group baseline, no significant change was shown in APD90, PCL or Smax obtained from different sites of left ventricle in the Control group, whereas a significant change was shown in APD90, PCL and Smax of those sites both at 30?min and 90?min after LF-EMF stimulation in the LF-EMF group (Fig. 3A–F).

An external file that holds a picture, illustration, etc.
Object name is srep30783-f3.jpg

Effect of LF-EMF stimulation on APD90 (A,B), PCL (C,D) and Smax (E,F) in the Control group (n?=?8) and EMF group (n?=?8). *P?<?0.05 and **P?<?0.05 as compared to the group baseline; #P?<?0.05 and ##P?<?0.05 as compared to the Control group. LVA, left ventricular apex; LVM, the median of left ventricle; LVB, left ventricular base; MAP, monophasic action potential; APD, action potential duration; APD90, monophasic action potential duration determined at 90% of repolarization; PCL, pacing cycle length of APD alternans; BH, baseline; Smax, the maximal slope of the restitution curve, other abbreviations are identical to Fig. 1.

Effect of LF-EMF stimulation on heart rate variability

Figure 4 demonstrates that both low frequency component (LF) and the ratio between LF the high component (LF/HF) were significantly decreased by LF-EMF stimulation both at 30?min and 90?min later but not by sham LF-EMF stimulation as compared to group baseline. In comparison with group baseline, acute myocardial infarction resulted in a significant change in LF (2.54?±?0.23?ms2 vs 1.72?±?0.12?ms2, P?<?0.01, Fig. 4A), high frequency component (HF, 1.01?±?0.08?ms2 vs 1.43?±?0.18?ms2, P?<?0.01, Fig. 4B) and LF/HF (2.51?±?0.34 vs 1.20?±?0.20, P?<?0.01, Fig. 4C) in the Control group, whereas those were kept at a normal level in the LF-EMF group (LF, 1.52?±?0.1?1?ms2 vs 1.68?±?0.10?ms2; HF, 1.43?±?0.12?ms2 vs 1.48?±?0.13?ms2; LF/HF, 1.06?±?0.10 vs 1.14?±?0.19, all P?>?0.05, Fig. 4A–C).

An external file that holds a picture, illustration, etc.
Object name is srep30783-f4.jpg

Effect of LF-EMF stimulation on LF (A), HF (B) and LF/HF (C) in the Control group (n?=?8) and EMF group (n?=?8). *P?<?0.05 and **P?<?0.01 vs group baseline; #P?<?0.05 and ##P?<?0.05 as compared to the Control group. LF, low frequency; HF, high frequency; LF/HF, the ratio between LF and HF; BH, baseline. Other abbreviations are identical to those in Fig. 1.

Effect of LF-EMF stimulation on serum norepinephrine and LSG function

In comparison with group baseline, serum norepinephrine was decreased from 180.3?±?6.8?pg/ml to 162.5?±?5.8?pg/ml at 30?min later and to 160.3?±?5.2?pg/ml at 90?min later in the LF-EMF group, whereas kept a stable level in the Control group (Fig. 5A). Furthermore, the systolic blood pressure increase in response to LSG stimulation was kept a baseline level in the Control group (Fig. 5B), whereas significantly attenuated by LF-EMF in the LF-EMF group at a voltage of 20–30?V as compared to group baseline (Fig. 5C). Take 25?V for example, the maximal systolic blood pressure increase induced by LSG stimulation was decreased from 88.3?±?15.4% to 43.1?±?6.2% (P?<?0.01) at 90?min later, whereas kept at about 90% in the Control group (Fig. 5B,C).

An external file that holds a picture, illustration, etc.
Object name is srep30783-f5.jpg

Effect of LF-EMF stimulation on serum NE (A) and LSG function (B,C) in the Control group (n?=?8) and EMF group (n?=?8). NS, P?>?0.05, *P?<?0.05 and **P?<?0.01 as compared to the Control group at the same time point. NE, norepinephrine. Other abbreviations are alike to those in Fig. 1.

Effect of LF-EMF stimulation on the neural activity of LSG

Figure 6A shows the representative examples of LSG neural activity at baseline, 30?min after LF-EMF stimulation, 90?min after LF-EMF stimulation and 15?min after acute myocardial infarction. Figure 6B,Cdemonstrates that no significant difference was shown both in the frequency and the amplitude of LSG neural activity between the Control group and the LF-EMF group. As compared to group baseline, LF-EMF stimulation resulted in a significant decrease in LSG neural activity at 30?min and 90?min later, whereas no significant change was caused by sham LF-EMF stimulation (Fig. 6B,C). Furthermore, as compared to baseline, the neural activity was significantly increased after acute myocardial infarction in the Control group (Frequency: 62.5?±?5.2impulse/min vs 112.2?±?8.1impulse/min, P?<?0.01; Amplitude: 0.18?±?0.03?mV vs 0.33?±?0.05?mV, P?<?0.01) but kept at a comparable level in the LF-EMF group (Frequency: 60.8?±?4.8impulse/min vs 65.6?±?4.8impulse/min, P?>?0.05; Amplitude: 0.19?±?0.02?mV vs 0.18?±?0.02?mV, P?>?0.05).

An external file that holds a picture, illustration, etc.
Object name is srep30783-f6.jpg

Representative examples (A) and quantitative analysis (B,C) of LSG neural activity in the Control group (n?=?8) and EMF group (n?=?8). **P?<?0.01 as compared to group baseline; #P?<?0.05 and ##P?<?0.05 as compared to the Control group. All abbreviations are identical to Figs 1 and ?and22.

Discussion

In the present study, we applied LF-EMF at the body surface of LSG. Both the ventricular electrophysiological parameters (APD90, PCL, Smax) and autonomic neural activity (serum norepinephrine, LSG function and LSG neural activity) were significantly affected by LF-EMF stimulation. Furthermore, the acute myocardial infarction-induced increased neural activity of LSG was significantly attenuated and the VAs was significantly reduced by LF-EMF. These findings suggested that exposure the LSG to LF-EMF might significantly reduce the neural activity of LSG, therefore reducing the incidence of VAs.

Previous studies have shown that activation of LSG facilitates, whereas inhibition of LSG protects against VAs,. In the past two decades, TMS has been widely used in clinical neurology,. Amounts of studies have shown that high-frequency stimulation increases cortical excitability, whereas low-frequency stimulation decreases neuronal excitability,. Recently, studies also demonstrated that TMS might affect the cardiac rhythm by modulating the autonomic nervous system. Scherlag et al. showed that high-frequency magnetic stimulation of the vagal nerves might induce atrial tachycardia and atrial fibrillation, which was eliminated after propranolol and atropine injection. Low-frequency stimulation of the vagal nerves, however, reduced the heart rate and decreased the voltage required to induce atrioventricular conduction block. Furthermore, recent study demonstrated that exposure the heart to the LF-EMF might significantly suppress atrial fibrillation and the mechanism might be by modulating the neural activity of atrial ganglionated plexus. In the present study, we found that exposure the LSG to the LF-EMF significantly reduced the serum norepinephrine, neural activity of LSG and VAs. All these indicate that noninvasive LF-EMF might reduce VAs by facilitating the autonomic rebalance, but what underlie the beneficial effects of LF-EMF on LSG was poorly defined.

In the present study, we suggested some possible mechanisms underlying the suppressing of LSG neural activity. Firstly, TMS, as an effective treatment for patients with neural disorders, has been implicated long-lasting therapeutic effects after the cessation of TMS treatment. Most researchers have contributed these effects to be long-term depression (LTD) and long-term potentiation (LTP) cause the duration of the effects seemed to implicate changes in synaptic plasticity. LTD is caused by low-frequency stimulation or the stimulation of a postsynaptic neuron, whereas LTP is caused by high-frequency stimulation or the stimulation of a presynaptic neuron. Ca++ signal, which is known to regulate membrane excitability and modulate second messengers related to multiple receptors and signal transduction pathways, has been shown to be the major determinant whether LTD or LTD arises,. Recently, Scherlag et al. also suggested that LTP or LTD was existed cause exposure the chest to the low-frequency electromagnetic field for 35?mins might result in the suppression of atrial fibrillation for 3 to 4?hours after the application of LF-EMF. In the present study, we also found that pretreatment with LF-EMF might significantly attenuated the acute myocardial infarction-induced activation of LSG neural activity and VAs, suggesting that LTP or LTD might be a potential explain for the salutary effects of LF-EMF stimulation. Secondly, previous studies have shown that TMS might also affect the expression levels of various receptors and other neuromediators, such as ?-adrenoreceptors, dopamine,,. In the present study, serum norepinephrine was significantly decreased after exposure to the LF-EMF, indicating that modulating the neurotransmitters might be one of the underlying mechanisms underlying the salutary effects of LF-EMF stimulation. Thirdly, previous studies also showed that TMS might also modulate dentritic sprouting (axon growth) and the density of synaptic contacts, and the authors suggested that these results are associated with the Brain-derived neurotrophic factor (BDNF)-tyrosine kinase B (TrkB) signaling system,. BDNF, as the most abundant neurotrophin in the brain, was reported to be a major contributor to the N-methyl-D-aspartate receptor-dependent LTP and LTD processes. Wang et al. demonstrated that low-frequency TMS might reduce BDNF levels. High-frequency stimulation, however, might increase serum BDNF levels and the affinity of BDNF for TrkB receptors. Furthermore, previous studies also showed that trancranial stimulation might result in the changes in neural-related proteins, such as c-fos and tyrosine hydroxylase, which are closely related with the neural remodeling processes,,. Autonomic neural remodeling, however, plays a key role in the initiation and maintenance of VAs,. All these implicate that modulating autonomic neural remodeling might be another mechanism of the antiarrhythmic effect of LF-EMF stimulation. Fourthly, the above mainly shows the underlying mechanisms of LF-EMF stimulation, but how can the LSG perceive the LF-EMF remains unknown. During the past few decades, many mechanisms, which might provide the basis for how the animals detect magnetic fields, have been proposed. However, the magnetoreceptors have not been identified with certainty in any animal, and the mode of transduction for the magnetic sense remains unknown. Recently, Xie et al. hypothesized that the putative magnetoreceptor, the iron-sulphur cluster protein, might combine with the magnetoreception-related photoreceptor cryptochromes to form the basis of magnetoreception in animals and this was corroborated in pigeon retina. Furthermore, Zhang et al. further showed that the cells which had been transfected iron-sulphur cluster protein might response to the remote magnetic stimulation. All these indicate that the iron-sulphur cluster protein might be the potential magnetoreceptor for the animals to detect the magnetic fields.

Though the present study showed wonderful results, but there are some limitations in this study. First, anesthesia with pentobarbital might affect the autonomic nervous system. However, this could be counteracted cause anesthesia was maintained continuously during the whole surgery and conducted in a same fashion in both groups. Second, the coil used in this study is too large to achieve LSG-targeted stimulation without affecting the surrounding tissues. It would be a great step forward if the coils could be technically improved. Third, we only observed the effect of LF-EMF in acute canine model. Fourth, we mainly focused on the autonomic nervous system imbalance, one of the major contributors of post-infarction VAs, cause we intervened the LSG with LF-EMF in this study. It’s a great limitation that some other major factors, like area at risk, infarct size, degree of collateral flow and the possibility of any preconditioning pathway were not involved in this study. However, previous studies have shown that LSG activation might facilitate the incidence of VAs, whereas pre-emptive or post-ischemic/infarction LSG inhibition by blockage or denervation might decrease the incidence of VAs and improve the infarct size, collateral flow, contractile force both in animals,,, and patients,. Furthermore, studies have shown that LSG stimulation might increase the likelihood of early or delayed afterdepolarization development and the initiation of reentry, thereby resulting in the incidence of VAs,,. In this study, LF-EMF stimulation of the LSG might significantly inhibit the neural activity of LSG, thereby reducing the incidence of VAs. Therefore, it’s reasonable to refer that improving the above factors might also be the potential mechanisms underlying the beneficial effects of LF-EMF stimulation, but further studies with optimized parameters and all-round considerations are required in the future.

In conclusion, the present study showed that LF-EMF stimulation might significantly reduce the neural function and neural activity of LSG. Exposure the LSG to the LF-EMF might be a feasible method for preventing the acute myocardial infarction-induced VAs. However, larger studies with optimized parameters should be done in the chronic models to verify the beneficial effect of LF-EMF stimulation.

Methods

Animal preparation

Sixteen canines weighing between 20 and 25?kg were included in this study. The experiments were approved by the Animal Ethics Committee of Wuhan University under approval number 2015–0445 and followed the guidelines outlined by the Care and Use of Laboratory Animals of the National Institutes of Health. All surgeries were performed under anesthesia with sodium pentobarbital at an initial dose of 30?mg/kg and a maintenance dose of 60?mg/h. The depth of anesthesia was evaluated by monitoring corneal reflexes, jaw tone, and alterations in cardiovascular indices. The body surface electrocardiogram was recorded throughout the experiment with a computer-based Lab System (Lead 2000B, Jingjiang Inc., Wuhan, China). The core body temperature of the dogs was kept at 36.5?±?1.5?°C. Left thoracotomy was conducted at the fourth intercostal space. At the end of the experiment, canines were a lethal dose of pentobarbital (100?mg/kg, iv).

LF-EMF

Repeated LF-EMF was supplied by the magnetic stimulation machine (YRD CCY-I, YiRuiDe Inc., Wuhan, China) with the curve 8 coil located at the body surface of the LSG (Fig. 1A). The LSG was stimulated by intermittent (8?s ON, 10?s OFF) LF-EMF stimulation with the frequency set at 1?HZ and intensity at approximately 90% of motor threshold (Fig. 1B). Motor threshold was defined as the lowest electromagnetic intensity that induced muscle contractions in the proximal forepaw and shoulder.

Monophasic action potential recording

Monophasic action potentials from the left ventricle were recorded with a custom-made Ag–AgCl catheter. A dynamic steady state pacing protocol (S1S1) was performed to determine action potential duration alternans. The pulse train was delivered at an initial cycle length slightly shorter than the sinus cycle length and the drive train of stimuli was maintained for 30?s to ensure a steady state, and then a 2-min interruption was taken to minimize the pacing memory effects. After that, another pulse train with the PCL decreased by 10?ms was delivered until action potential duration alternans appeared. Action potential duration alternans was defined as ?APD90?10?ms for ?5 consecutive beats. The monophasic action potential recordings were analyzed by the LEAD 2000B work station system (Lead 2000B, Jingjiang Inc. China). The APD90 was defined as the 90% repolarization duration and the diastolic interval was the time interval from the previous APD90 point to the activation time of the following beat. As described in previous studies, the dynamic action potential duration restitution curves were constructed from (Diastolic interval, APD90) pairs using Origin 8.0 (OriginLab, Co., Northampton, MA, USA),. Slope of the shortest diastolic interval was defined as Smax.

Measurements of heart rate variability

Spectral power for heart rate variability was analyzed on 5-minute electrocardiogram recording segments and an autoregressive algorithm was used to analyze digitized signals from the electrocardiographic recordings. The following power spectral variables were determined: HF, LF and LF/HF.

Neural recording from the LSG

To record the neural activity of the LSG, one tungsten-coated microelectrode was inserted into the fascia of the LSG and one ground lead was connected to the chest wall. The signal of the LSG was recorded with a PowerLab data acquisition system (8/35, AD Instruments, Australia) and amplified by an amplifier (DP-304, Warner Instruments, Hamden, CT, USA). The band-pass filters were set at 300?Hz to 1?kHz and the amplification ranges from 30 to 50 times. The neural activity, deflections with a signal-to-noise ratio greater than 3:1, was manually determined as described in our previous studies,,.

LSG function

LSG function was measured as the LSG stimulation-induced maximal change in systolic blood pressure as described in our previous study. High frequency stimulation (20?Hz, 0.1?ms pulse duration) was applied to the LSG using a stimulator (Grass-S88; Astro-Med, West Warwick, RI, USA). The voltage ranged from 20?V to 30?V and increased by 5?V. To eliminate the residual effect of the LSG stimulation, each stimulation should be less than 30?s and the next stimulation should be not be taken until the blood pressure returned to a normal level.

Blood sampling

Venous blood samples were collected. Serum was separated by centrifuging at 3000?rpm for 15?min at 4?°C, and stored at ?80?°C until assayed. The serum norepinephrine level was measured with a canine-specific high sensitivity ELISA kit (Nanjing Jiancheng Bioengineering Institute, Nanjing City, China).

Measurement of the acute myocardial infarction-induced VAs

The left anterior descending coronary artery was ligated at approximately 2.5?centimeters away from its origin to induce acute myocardial infarction. The incidence and duration of the VAs induced by acute myocardial infarction during the first hour was analyzed. The VAs recorded on the ECG were defined as following: VPBs, identifiable premature QRS complexes; VT, three or more consecutive VPBs; non-sustained VT, VT terminating spontaneously within 30?s; sustained VT, VT sustained for more than 30?s; and VF, a tachycardia with random ECG morphology and an associated loss of arterial blood pressure that degenerates into ventricular asystole.

Experimental protocol

Sixteen dogs were randomly divided into LF-EMF group (n?=?8, with LF-EMF) and Control group (n?=?8, with sham LF-EMF). LF-EMF (1?HZ; stimulation time 8?s; interstimulus interval, 5?s) was delivered to the surface area of LSG for 90?minutes. As shown in Fig. 1C, monophasic action potential, heart rate variability, serum norepinephrine, LSG function and LSG neural activity were measured at baseline, 30?min and 90?min after LF-EMF treatment. Measurements of heart rate variability and LSG neural activity were repeated at 15?min after acute myocardial infarction. Furthermore, the incidence of VAs was recorded during the first hour after acute myocardial infarction.

Statistical analysis

Continuous variables are presented as the mean?±?SEM and were analyzed by t test, one-way ANOVA, or two-way repeated-measures ANOVA with a Bonferroni posthoc test. To compare the incidence of VF between groups, Fisher’s exact test was used. All data was analyzed by GraphPad Prism version 5.0 software (GraphPad Software, Inc., San Diego, CA), and two-tailed P???0.05 was considered significant.

Additional Information

How to cite this article: Wang, S. et al. Noninvasive low-frequency electromagnetic stimulation of the left stellate ganglion reduces myocardial infarction-induced ventricular arrhythmia. Sci. Rep. 6, 30783; doi: 10.1038/srep30783 (2016).

Acknowledgments

This work was supported by the grants from National Natural Science Foundation of China No. 81270339, No. 81300182, No. 81530011, No. 81570463, grant from the Natural Science Foundation of Hubei Province No. 2013CFB302, and grants from the Fundamental Research Funds for the Central Universities No. 2042014kf0110 and No. 2042015kf0187.

Footnotes

Author Contributions S.W. and X.Z. wrote the main manuscript text and prepared figures; B.H., Z.W., L.Z. and M.W. performed experiments and anlalyzed data; L.Y. and H.J. designed the project and revised the paper. All authors reviewed and approved the final version.

References

  • Ajijola O. A. & Shivkumar K. Neural remodeling and myocardial infarction: the stellate ganglion as a double agentJournal of the American College of Cardiology. 59, 962–964 (2012). [PMC free article] [PubMed]
  • Han S. et al. . Electroanatomic remodeling of the left stellate ganglion after myocardial infarctionJournal of the American College of Cardiology. 59, 954–961 (2012). [PMC free article] [PubMed]
  • Saffitz J. E. Sympathetic neural activity and the pathogenesis of sudden cardiac deathHeart rhythm.5, 140–141 (2008). [PubMed]
  • Zhou S. et al. . Spontaneous stellate ganglion nerve activity and ventricular arrhythmia in a canine model of sudden deathHeart rhythm. 5, 131–139 (2008). [PubMed]
  • Hayase J., Patel J., Narayan S. M. & Krummen D. E. Percutaneous stellate ganglion block suppressing VT and VF in a patient refractory to VT ablationJournal of cardiovascular electrophysiology. 24, 926–928 (2013). [PMC free article] [PubMed]
  • Funamizu H., Ogiue-Ikeda M., Mukai H., Kawato S. & Ueno S. Acute repetitive transcranial magnetic stimulation reactivates dopaminergic system in lesion ratsNeuroscience letters. 383, 77–81 (2005). [PubMed]
  • Cabrerizo M. et al. . Induced effects of transcranial magnetic stimulation on the autonomic nervous system and the cardiac rhythmScientificWorldJournal. 2014, 349718 (2014). [PMC free article][PubMed]
  • Scherlag B. J. et al. . Magnetism and cardiac arrhythmiasCardiol Rev. 12, 85–96 (2004). [PubMed]
  • Yu L. et al. . The use of low-level electromagnetic fields to suppress atrial fibrillationHeart rhythm: the official journal of the Heart Rhythm Society. 12, 809–817 (2015). [PubMed]
  • Chen P. S. et al. . Sympathetic nerve sprouting, electrical remodeling and the mechanisms of sudden cardiac deathCardiovasc Res. 50, 409–416 (2001). [PubMed]
  • Kobayashi M. & Pascual-Leone A. Transcranial magnetic stimulation in neurologyLancet Neurol.2, 145–156 (2003). [PubMed]
  • Wassermann E. M. & Lisanby S. H. Therapeutic application of repetitive transcranial magnetic stimulation: a reviewClin Neurophysiol. 112, 1367–1377 (2001). [PubMed]
  • Chervyakov A. V., Chernyavsky A. Y., Sinitsyn D. O. & Piradov M. A. Possible Mechanisms Underlying the Therapeutic Effects of Transcranial Magnetic StimulationFront Hum Neurosci9, 303 (2015). [PMC free article] [PubMed]
  • Gaetani R. et al. . Differentiation of human adult cardiac stem cells exposed to extremely low-frequency electromagnetic fieldsCardiovasc Res. 82, 411–420 (2009). [PubMed]
  • Waxman S. G. & Zamponi G. W. Regulating excitability of peripheral afferents: emerging ion channel targetsNat Neurosci. 17, 153–163 (2014). [PubMed]
  • Frye R. E., Rotenberg A., Ousley M. & Pascual-Leone A. Transcranial magnetic stimulation in child neurology: current and future directionsJ Child Neurol. 23, 79–96 (2008). [PMC free article][PubMed]
  • Hemond C. C. & Fregni F. Transcranial magnetic stimulation in neurology: what we have learned from randomized controlled studiesNeuromodulation10, 333–344 (2007). [PubMed]
  • Amassian V. E., Stewart M., Quirk G. J. & Rosenthal J. L. Physiological basis of motor effects of a transient stimulus to cerebral cortexNeurosurgery. 20, 74–93 (1987). [PubMed]
  • Di Lazzaro V., Ziemann U. & Lemon R. N. State of the art: Physiology of transcranial motor cortex stimulationBrain Stimul 1, 345–362 (2008). [PubMed]
  • Ziemann U. et al. . TMS and drugs revisited 2014Clin Neurophysiol (2014). [PubMed]
  • Wang H. Y. et al. . Repetitive transcranial magnetic stimulation enhances BDNF-TrkB signaling in both brain and lymphocyteThe Journal of neuroscience: the official journal of the Society for Neuroscience31, 11044–11054 (2011). [PMC free article] [PubMed]
  • Wiltschko R. W., W. Provides a comprehensive review of magbetoreception research and its history up to 1995Spinger (1995).
  • Johnsen S. & Lohmann K. J. The physics and neurobiology of magnetoreceptionNat Rev Neurosci.6, 703–712 (2005). [PubMed]
  • Qin S. et al. . A magnetic protein biocompassNat Mater (2015).
  • Long X., Ye J., Zhao D. & Zhang S. J. Magnetogenetics: remote non-invasive magnetic activation of neuronal activity with a magnetoreceptorSci. Bull. 1–13 (2015). [PMC free article] [PubMed]
  • Kingma J. G., Simard D., Voisine P. & Rouleau J. R. Influence of cardiac decentralization on cardioprotectionPLoS One. 8, e79190 (2013). [PMC free article] [PubMed]
  • Jones C. E., Devous M. D. Sr., Thomas J. X. Jr. & DuPont E. The effect of chronic cardiac denervation on infarct size following acute coronary occlusionAm Heart J. 95, 738–746 (1978).[PubMed]
  • Thomas J. X. Jr., Randall W. C. & Jones C. E. Protective effect of chronic versus acute cardiac denervation on contractile force during coronary occlusionAm Heart J. 102, 157–161 (1981).[PubMed]
  • Yokoyama M. et al. . An experimental study on the role of coronary collateral development in preservation and improvement of contractile force in the ischemic myocardiumJpn Circ J. 42, 1249–1256 (1978). [PubMed]
  • Biagini A. et al. . Treatment of perinfarction recurrent ventricular fibrillation by percutaneous pharmacological block of left stellate ganglionClin Cardiol. 8, 111–113 (1985). [PubMed]
  • Hartikainen J., Mustonen J., Kuikka J., Vanninen E. & Kettunen R. Cardiac sympathetic denervation in patients with coronary artery disease without previous myocardial infarctionAm J Cardiol. 80, 273–277 (1997). [PubMed]
  • Huffaker R., Lamp S. T., Weiss J. N. & Kogan B. Intracellular calcium cycling, early afterdepolarizations, and reentry in simulated long QT syndromeHeart Rhythm. 1, 441–448, doi: 10.1016/j.hrthm.2004.06.005 (2004). [PubMed] [Cross Ref]
  • Priori S. G., Mantica M. & Schwartz P. J. Delayed afterdepolarizations elicited in vivo by left stellate ganglion stimulationCirculation. 78, 178–185 (1988). [PubMed]
  • Shimizu W. & Antzelevitch C. Cellular basis for the ECG features of the LQT1 form of the long-QT syndrome: effects of beta-adrenergic agonists and antagonists and sodium channel blockers on transmural dispersion of repolarization and torsade de pointesCirculation. 98, 2314–2322 (1998).[PubMed]
  • He B. et al. . Effects of ganglionated plexi ablation on ventricular electrophysiological properties in normal hearts and after acute myocardial ischemiaInt J Cardiol. 168, 86–93 (2013). [PubMed]
  • Banville I., Chattipakorn N. & Gray R. A. Restitution dynamics during pacing and arrhythmias in isolated pig heartsJournal of cardiovascular electrophysiology. 15, 455–463 (2004). [PubMed]
  • He B. et al. . Effects of low-intensity atrial ganglionated plexi stimulation on ventricular electrophysiology and arrhythmogenesisAutonomic neuroscience: basic & clinical174, 54–60 (2013). [PubMed]
  • Huang B. et al. . Left renal nerves stimulation facilitates ischemia-induced ventricular arrhythmia by increasing nerve activity of left stellate ganglionJournal of cardiovascular electrophysiology. 25(2014). [PubMed]
  • Yu L. et al. . Low-level transcutaneous electrical stimulation of the auricular branch of the vagus nerve: a noninvasive approach to treat the initial phase of atrial fibrillationHeart rhythm. 10, 428–435 (2013). [PubMed]
  • Wang S. et al. . Spinal cord stimulation suppresses atrial fibrillation by inhibiting autonomic remodelingHeart rhythm. 13, 274–281 (2016). [PubMed]
  • Wang S. et al. . Spinal cord stimulation protects against ventricular arrhythmias by suppressing left stellate ganglion neural activity in an acute myocardial infarction canine modelHeart rhythm. 12, 1628–1635 (2015). [PubMed]
  • Walker M. J. et al. . The Lambeth Conventions: guidelines for the study of arrhythmias in ischaemia infarction, and reperfusionCardiovascular research 22, 447–455 (1988). [PubMed]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group