Safety and acceptability of an organic light-emitting diode sleep mask as a potential therapy for retinal disease.
Author information
- 1St Paul’s Eye Unit, Royal Liverpool University Hospitals NHS Trust, Liverpool, UK.
- 2Department of Eye and Vision Science, Institute of Ageing and Chronic Disease, University of Liverpool, Liverpool, UK.
- 3Department of Biostatistics, Institute of Translational Medicine, University of Liverpool, Liverpool, UK.
- 4Department of Psychological Sciences, Institute of Psychology, Health and Society, Liverpool, UK.
- 5Polyphotonix Medical Ltd, Durham, UK.
Abstract
Purpose
The purpose of the study was to study the effect of an organic light-emitting diode sleep mask on daytime alertness, wellbeing, and retinal structure/function in healthy volunteers and in diabetic macular oedema (DMO).
Patients and methods
Healthy volunteers in two groups, 18-30 yrs (A), 50-70 yrs (B) and people with DMO (C) wore masks (504 nm wavelength; 80 cd/m2 luminance; <8 h) nightly for 3 months followed by a 1-month recovery period. Changes from baseline were measured for (means): psychomotor vigilance task (PVT) (number of lapses (NL), response time (RT)), sleep, depression, psychological wellbeing (PW), visual acuity, contrast sensitivity, colour, electrophysiology, microperimetry, and retinal thickness on OCT.
Results
Of 60 participants, 16 (27%) withdrew, 8 (13%) before month 1, due to sleep disturbances and mask intolerance. About 36/55 (65%) who continued beyond month 1 reported >1 adverse event. At month 3 mean PVT worsened in Group A (RT (7.65%, P<0.001), NL (43.3%, P=0.005)) and mean PW worsened in all groups (A 28.0%, P=0.01, B 21.2%, P=0.03, C 12.8%, P<0.05). No other clinically significant safety signal was detected. Cysts reduced/resolved in the OCT subfield of maximal pathology in 67% Group C eyes. Thinning was greater at 3 and 4 months for greater baseline thickness (central subfield P<0.001, maximal P<0.05).
Conclusion
Sleep masks showed no major safety signal apart from a small impairment of daytime alertness and a moderate effect on wellbeing. Masks were acceptable apart from in some healthy participants. Preliminary data suggest a beneficial effect on retinal thickness in DMO. This novel therapeutic approach is ready for large clinical trials.Eye advance online publication, 16 December 2016; doi:10.1038/eye.2016.259.
Photobiomodulation for the treatment of retinal diseases: a review.
1Department of Ophthalmology, State University of New York, Upstate Medical University, Center for Vision Research, Syracuse, NY 13202, USA.
Abstract
Photobiomodulation (PBM), also known as low level laser therapy, has recently risen to the attention of the ophthalmology community as a promising new approach to treat a variety of retinal conditions including age-related macular degeneration, retinopathy of prematurity, diabetic retinopathy, Leber’s hereditary optic neuropathy, amblyopia, methanol-induced retinal damage, and possibly others. This review evaluates the existing research pertaining to PBM applications in the retina, with a focus on the mechanisms of action and clinical outcomes. All available literature until April 2015 was reviewed using PubMed and the following keywords: “photobiomodulation AND retina”, “low level light therapy AND retina”, “low level laser therapy AND retina”, and “FR/NIR therapy AND retina”. In addition, the relevant references listed within the papers identified through PubMed were incorporated. The literature supports the conclusion that the low-cost and non-invasive nature of PBM, coupled with the first promising clinical reports and the numerous preclinical-studies in animal models, make PBM well-poised to become an important player in the treatment of a wide range of retinal disorders. Nevertheless, large-scale clinical trials will be necessary to establish the PBM therapeutic ranges for the various retinal diseases, as well as to gain a deeper understanding of its mechanisms of action.
Near-Infrared Photobiomodulation in Retinal Injury and Disease.
1Department of Biomedical Sciences, University of Wisconsin-Milwaukee, 2400 E. Hartford Ave., 53201, Milwaukee, WI, USA. jeells@uwm.edu.
2College of Nursing, University of Wisconsin-Milwaukee, 53201, Milwaukee, WI, USA. sandeep@uwm.edu.
3Divsion of Biomedical Sciences, Research School of Biology, Australian National University, 0200, Acton, Australia. krisztina.valter-kocsi@anu.edu.au.
Photobiomodulation Mitigates Diabetes-Induced Retinopathy by Direct and Indirect Mechanisms: Evidence from Intervention Studies in Pigmented Mice
Conceived and designed the experiments: TK BAB. Performed the experiments: AS YD HL SP RR. Analyzed the data: TK YD. Contributed reagents/materials/analysis tools: BAB. Wrote the paper: TK.
Abstract
Objective
Daily application of far-red light from the onset of diabetes mitigated diabetes-induced abnormalities in retinas of albino rats. Here, we test the hypothesis that photobiomodulation (PBM) is effective in diabetic, pigmented mice, even when delayed until weeks after onset of diabetes. Direct and indirect effects of PBM on the retina also were studied.
Methods
Diabetes was induced in C57Bl/6J mice using streptozotocin. Some diabetics were exposed to PBM therapy (4 min/day; 670 nm) daily. In one study, mice were diabetic for 4 weeks before initiation of PBM for an additional 10 weeks. Retinal oxidative stress, inflammation, and retinal function were measured. In some mice, heads were covered with a lead shield during PBM to prevent direct illumination of the eye, or animals were treated with an inhibitor of heme oxygenase-1. In a second study, PBM was initiated immediately after onset of diabetes, and administered daily for 2 months. These mice were examined using manganese-enhanced MRI to assess effects of PBM on transretinal calcium channel function in vivo.
Results
PBM intervention improved diabetes-induced changes in superoxide generation, leukostasis, expression of ICAM-1, and visual performance. PBM acted in part remotely from the retina because the beneficial effects were achieved even with the head shielded from the light therapy, and because leukocyte-mediated cytotoxicity of retinal endothelial cells was less in diabetics treated with PBM. SnPP+PBM significantly reduced iNOS expression compared to PBM alone, but significantly exacerbated leukostasis. In study 2, PBM largely mitigated diabetes-induced retinal calcium channel dysfunction in all retinal layers.
Conclusions
PBM induces retinal protection against abnormalities induced by diabetes in pigmented animals, and even as an intervention. Beneficial effects on the retina likely are mediated by both direct and indirect mechanisms. PBM is a novel non-pharmacologic treatment strategy to inhibit early changes of diabetic retinopathy.
Introduction
Diabetes is a major cause of visual impairment, and there is considerable clinical and research interest in diabetic retinopathy. Proven therapeutic approaches, such as good glycemic control, high energy laser photocoagulation, or intravitreal injections of anti-VEGF therapies or triamcinolone, are invasive, damaging, or require direct involvement by health-care professionals, and not all patients respond to these approaches. Supplemental therapeutic approaches are needed.
Photobiomodulation (PBM) is the application of low-level light that has a biological effect, such as to relieve pain or heal wounds. Numerous studies have shown that light in the far-red to near-infrared region of the spectrum (630–1000 nm) can have beneficial effects in vitro and in vivo to heal existing tissue damage and to inhibit the development of tissue pathology. Medical PBM using coherent (lasers) or noncoherent (Light Emitting Diodes; LEDs) light has been found to have beneficial effects in a variety of conditions, including accelerated healing of wounds and ulcers, cardiac ischemia, stroke, Parkinson’s disease, and optic nerve degeneration [1–12]. Studies related to the retina likewise have demonstrated that the low intensity light treatment mitigates pathology in retinal degeneration models [4,13–16], and recently, also in diabetic retinopathy [17,18]. Our previous study in diabetic albino rats showed that whole-body exposure to far-red light (670 nm) for only 4 minutes per day from the onset of diabetes mitigated abnormalities that are believed to contribute to diabetic retinopathy, including increased generation of superoxide, induction of a local pro-inflammatory environment, and dysfunction or degeneration of retinal neurons [18].
The purpose of the present study was to extend those studies to determine if PBM would have similar beneficial effects under the following different conditions: (i) in another species (mice), (ii) in the presence of heavy pigmentation (C57Bl/6J), (iii) as an intervention therapy, (iv) when direct exposure of the eyes to the PBM was blocked, and (v) when activity of the antioxidant enzyme, heme oxygenase 1 (HO-1), was inhibited. Our results suggest that the PBM has both neuronal and vascular beneficial effects on pigmented diabetic mice, and that this effect is mediated at least in part systemically.
Materials and Methods
This study was performed in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research, and with authorization of the Institutional Animal and Care Use Committee (IACUC) at Case Western Reserve University and Wayne State University. Animals were housed and maintained in normal 12h:12h light-dark cycle laboratory lighting.
Animals
Male C57BL/6J mice were obtained from the Jackson Laboratory, and were housed in ventilated microisolator with free access to water and food. Diabetes was induced at 2–3 months of age by intraperitoneal injection of a freshly prepared solution of streptozotocin in citrate buffer (55 mg/Kg of body weight for five consecutive days). Insulin was given as 0–0.2 units subcutaneously between 0–3 times a week to inhibit weight loss, while still allowing hyperglycemia. To allow the animals to stabilize somewhat after induction of diabetes, blood glucose concentration was not measured until at least 7 days after the final administration of streptozotocin. Blood glucose was determined with a portable glucose meter, using blood collected from the tail vein under nonfasting conditions. The onset of diabetes was defined as three consecutive measures of blood glucose over than 275 mg/dl. HbA1c was measured as reported previously (Study 1 [19,20]; Study 2 [21].
There were two parts to this work. In the first, five groups with n = 12 animals per group were assigned as:(i) non-diabetic controls, (ii) diabetic controls, (iii) diabetic exposed to PBM starting 4 weeks after the induction of diabetes, (iv) diabetic exposed to PBM while the head was shielded from the light by a lead covering, and (v) diabetic treated with a heme oxygenase-1 (HO-1) inhibitor (tin protoporphyrin, SnPP; Frontier Scientific Inc, Logan, UT) [22], starting 4 weeks after the induction of diabetes. All animals were euthanized at 14 weeks of diabetes (5–6 months of age). In the second study, three groups were studied: (1) non-diabetic untreated control (n = 9), (2) diabetic untreated control (n = 3), and (3) diabetic treated with PBM from the onset of diabetes (n = 5). These animals were humanely euthanized at 8 weeks of diabetes.
Photobiomodulation
The far-red light was generated by LEDs (SpectraLife™; Quantum Devices, WI). This device was determined to deliver 670nm light at a power of 20.25 mW/cm2 at the 2–3 cm distance used between the device and the animal (measured with Spectro-radiometer; specbos 1211UV, Dataoptics, Inc, Ypsilanti MI). The mice were exposed to this radiation for 240 sec each day for the 10 weeks. The daily radiant exposure was thus 240 x 20.25 = 4860 mJ/cm2 (or ~5 J/cm2). In study 1, treated mice were placed in a DecapiCone™ restrainer bag (Braintree Scientific, Braintree, MA), and then in an open-top polypropylene holder using a Velcro strap to secure the animals. To ensure that the polypropylene bag would not impair passage of the red light, transmittance through the bag was tested; compared to the air, one layer of the plastic used to restrain the animals absorbed 8.2% of the light (0.082 Abs) at 670 nm. Intervention with PBM treatment was started four weeks after the onset of diabetes, and was continued for ten additional weeks. To minimize handling, animals in study 2 were allowed free movement in a small space during PBM. PBM was started immediately after confirmation of diabetes in this experimental study.
Retinal Superoxide
Fresh retinas from animals were analyzed for superoxide production as previously described [18,23,24]. Briefly, retinas were placed in 0.2 ml of Krebs/HEPES buffer and allowed to equilibrate in the dark at 37°C under 95% O2/5% CO2 conditions for 20 min. To each tube, 0.5 mM lucigenin (Sigma Chemical Company, St. Louis, MO) was added and incubated for an additional 10 minutes before having the photon emission detected by a luminometer (Analytical Luminescence Laboratory, San Diego, CA). Retinal protein was quantified (Bio-Rad), and the luminescence expressed per mg of protein.
HO-1 inhibition
Activity of HO-1 was inhibited systemically with SnPP in one of the diabetic groups getting the PBM treatment. The SnPP was freshly made dissolved in 0.2 N NaOH, adjusted to physiological pH 7.4 with 1N HCl, and protected from light. Mice received 100 ?mol/kg once per week by intraperitoneal injection. This dose of SnPP has been reported to inhibit HO-1 activity in vivo [25].
Leukostasis
Blood was removed from the vasculature of anesthetized animals by perfusion with phosphate-buffered saline (PBS; 10 mM phosphate buffer, 2.7 mM potassium chloride and 137 mM sodium chloride, pH 7.4; Sigma-Aldrich, St. Louis, MO) via a heart catheter. Animals were then perfused with fluorescein-coupled concanavalin A lectin (20 ?g/ml in PBS; Vector Laboratories, Burlingame, CA), as described previously [20,23,26]. Flat-mounted retinas were imaged via fluorescence microscopy, and the number of leukocytes adherent to the vascular wall was counted.
Visual Function
The virtual optokinetic system (OptoMetry; CerebralMechanics, Inc,) was used as described previously [19,27]. At 14 weeks of diabetes, mice were allowed to move freely on the platform of the visual OptoMotor system while the visual stimulus was projected around the platform. Spatial frequency threshold was measured at maximum contrast. For contrast sensitivity, only a single value (0.064 c/d; the maximal point in a full contrast sensitivity curve) was measured. These tests are psychophysical measures that assess function of both retinal and central visual pathways. Each measurement was repeated several times to evaluate the reproducibility of responses. The grader was masked with respect to the animals’ experimental group.
Immunoblots
Immunoblots of ICAM-1 (intercellular adhesion molecule-1; 1:500 dilution, R&D Systems, MN), iNOS (1:1000 dilution, Santa Cruz, CA) and HO-1 (1:1000 dilution, Cell Signaling Technology, Inc., Danvers, MA) were performed using the respective antibodies. The retina or cells was isolated and placed into 80 ?l of lysis buffer supplemented with protease inhibitor (1:1000 dilution), sonicated and centrifuged. The supernatant was collected and each sample containing the same amount of protein was fractionated by SDS-PAGE and electroblotted to PVDF membranes. After blocking nonspecific binding with 5% BSA, the membranes were incubated with rabbit polyclonal antibodies followed by incubation with antibody against rabbit IgG. Densities were normalized to that of ß-actin in the same lane (1:3000 dilution, Abcam, Inc., Cambridge, MA).
Leukocyte-mediated killing of retinal endothelial cells [20,23,28]
Transformed mouse retinal endothelial cells (mREC; generated from Immortomice [29]) were grown in DMEM containing 10% FBS and 5 or 25 mM glucose. Cells were cultured at 37°C in 5% CO2 and 95% air, and the media was changed every other day for 5 days. When mRECs were 80% confluent (approx. 500,000 cells), leukocytes (100,000; enriched from blood with RBC lysis buffer) from animals in the nondiabetic, diabetic, and diabetic treated with PBM groups were added to the mREC and incubated for 24 hrs [23]. After incubation, the leukocytes were carefully removed by gentle washing, and viability of remaining retinal endothelial cells was measured by trypan blue exclusion. Briefly, an aliquot of the endothelial cell suspension was diluted 1:1 (vol/vol) with 0.1% trypan blue, and the cells were counted with a hemocytometer. Cell death was reported as the percentage of blue-stained cells (dead cells) of the total number of cells. Approximately 200–400 cells were counted in each sample.
MEMRI
MEMRI is the imaging modality of choice for non-invasively studying the function of voltage-gated Ca(2+) channels on excitable cells, such as rod cell L-type calcium channels [30,31]. The MEMRI procedure in mice has been described previously [32–35]. MEMRI data from the central retinal (± 1 mm from the center of the optic nerve) were analyzed using the region-of-interest following our prior procedure [32–35]. The resolution obtained in the central retina is sufficient for extracting meaningful layer-specific anatomical and functional data, as previously discussed [36,37]. In the present studies, whole-retinal thicknesses in nondiabetic mice was ~ 220 ?m studied with an axial pixel size of 25 ?m [36]. Thus, the spatial uncertainty is ~ ½ pixel thick (~12.5 ?m) [36]. We rely on the well-defined laminar structure of the retina to distinguish, for example, inner retinal uptake from outer retinal uptake.
Statistical Analyses
Data were expressed as means ±SD, unless otherwise noted. Groups were compared using analysis-of-variance followed by Fischer’s test, with p ? 0.05 being considered statistically significant. MEMRI data (mean ± SEM) were analyzed using a generalized estimating equation (GEE) approach which performs a general linear regression analysis using contiguous locations or measurements in each subject and accounts for the within-subject correlation between contiguous locations or measurements [37,38]. Comparisons of MEMRI data between groups were performed using individual t-tests at different locations of the intraretinal profiles; those selected regions identified from the t-tests as significant were then analyzed using GEE [37,38]
Results
Animals
After injection with STZ, the presence of diabetes was confirmed based on blood glucose levels and body weight. Over the weeks of diabetes, the mean blood glucose level, HbA1c and body weight were significantly different between STZ-treated mice and control mice (Tables ?(Tables11 and ?and2).2). PBM treatment had no significant effect on body weight, non-fasting blood glucose or HbA1c compared to the other diabetic groups.
Study 1
Intervention with PBM mitigated diabetes-induced molecular abnormalities in retinas from pigmented mice
In wildtype C57Bl/6J mice, diabetes caused metabolic and physiologic abnormalities in the retina, including increased superoxide production, leukostasis (Fig 1), increased expression of ICAM-1 and iNOS, and subnormal expression of HO-1 (Fig 2). Diabetes of 2 months duration also significantly impaired visual function, as assessed from spatial frequency threshold and contrast sensitivity (measured at a single point; 0.064 c/d) (not shown; both p<0.0001). Although initiation of the PBM therapy in these pigmented animals was delayed for 1 month of untreated diabetes, the subsequent intervention with PBM therapy nevertheless significantly mitigated many of these defects. Intervention with daily exposure to the PBM totally inhibited the increase in retinal superoxide, and significantly inhibited diabetes-induced abnormalities in leukostasis, retinal ICAM-1 expression, and spatial frequency threshold (p<0.0001). The light therapy had no significant effect on the diabetes-induced changes in retinal iNOS or HO-1 or defect in contrast sensitivity measured in these samples.
HO-1
In vitro studies previously showed that incubation of retinal cells in 30 mM glucose caused a significant reduction in HO-1 expression, and that PBM significantly inhibited this reduction [18]. To determine if this effect on HO-1 contributed to the observed beneficial effects of PBM in vivo, we simultaneously administered PBM along with a pharmacologic inhibitor of HO-1 (SnPP) for the 10 weeks with the light treatment. Pharmacologic inhibition of HO-1 in vivo completely prevented the benefits of PBM in the diabetes-induced increase in retinal leukostasis (Fig 1), suggesting that the beneficial effect of PBM on leukocyte adhesion required HO-1. In contrast, inhibition of HO-1 did not counteract the effect of PBM on the diabetes-induced generation of superoxide or expression of ICAM-1, iNOS or HO-1. In fact, inhibition of HO-1 during PBM suppressed the diabetes-induced induction of iNOS expression better than that observed with PBM alone. Surprisingly, both the head shield and SNPP increased HO-1 expression. Administration of SnPP to PBM-treated diabetics had no significant effect on spatial frequency threshold or single point contrast sensitivity compared to animals treated with PBM only (not shown).
Beneficial effects of PBM are mediated in part via systemic effects
To test if some of the observed beneficial effects of PBM on retina were mediated systemically, an opaque (lead) head shield was used to prevent direct irradiation to the eye. Neither retinal superoxide production, leukostasis, iNOS (Figs ?(Figs11 and ?and2),2), nor the tests of visual function differed appreciably between the diabetics getting PBM with or without the head shield, suggesting that the beneficial effects of PBM on the retina in diabetes did not require direct illumination of the head or eyes for these parameters. As an additional test of PBM’s systemic effects, we assessed the ability of PBM to exert beneficial effects on leukocytes flowing in the systemic circulation. We previously have found that leukocytes play a major role in diabetes-induced degeneration of retinal capillaries [23,39]. Consistent with our prior reports, leukocytes from control diabetics (not treated with PBM) caused significantly more endothelial cytotoxicity in co-cultures than did leukocytes from nondiabetic animals (Fig 3). Intervention with PBM for only 4 min per day totally suppressed the diabetes-induced killing of retinal endothelial cells by leukocytes from diabetic mice.
Study 2
PBM mitigated diabetes-induced calcium channel dysfunction across all retinal layers
As previously reported [21,33], diabetes reduced manganese uptake across the retina in the dark compared with non-diabetic mice (Fig 4). PBM-treated diabetic mice exhibited largely normal calcium channel function in all layers of the retina, except in the presumptive rod inner segment layer.
Discussion
PBM is a novel therapeutic approach to mitigate the development of diabetic retinopathy, and preliminary studies in diabetic rodents and patients have shown promise [17,18]. Of note, the therapy is easy to administer, and the beneficial effects were detected at a low amount of daily radiant exposure. We demonstrate herein that the beneficial effects of PBM are mediated at least in part via indirect effects, and occur even if the initiation of therapy is delayed (post-conditioning).
We used a head shield to determine if observed beneficial effects of PBM on the retina required direct illumination of the retina. The diabetic mice that had their heads covered to prevent light from reaching the eyes for the 4 min of illumination nevertheless showed beneficial effects of the PBM treatment with respect to superoxide generation, leukostasis, expression of inflammatory proteins, and visual function. Previously, others [11,12,41] reported that beneficial effects of PBM in a model of Parkinson’s disease were not inhibited by a head shield, likewise suggesting that the neuroprotective effects of PBM in that model were mediated at least partly by indirect (systemic) means. Indirect effects of PBM detected also in other studies include where treatment of one side of the body had beneficial effects also on the untreated side with regard to skin blood flow, temperature in the feet of diabetic patients [42], or healing of skin wounds and burns [43,44]. Previously reported beneficial effects of PBM in kidney and heart [7,8] of diabetic animals are consistent with PBM exerting at least some effects via systemic mediators, but far-red light is known to penetrate deeply into tissues, and thus might directly irradiate those tissues.
The molecular and cellular changes initiated by PBM which mediate observed beneficial effects are under investigation. Mitochondrial cytochrome c oxidase is often considered to be a target of PBM therapy [15,45–47], although a recent study from our group did not find evidence to support this in the retina of diabetic rats [18]. Intriguingly, MEMRI studies showed that PBM did not inhibit diabetes-induced defects in ion movement in the inner segment layer of retinal photoreceptors, the region that contains the majority of retinal mitochondria. Thus our findings provide suggest that PBM exerts beneficial effects that are independent of photoreceptor mitochondria.
In addition, several studies have demonstrated that PBM can activate stem cells to proliferate [48–50]. This might be relevant, since release of stem cells and progenitor cells from bone marrow is impaired in diabetes [51–54], and administration of stem cells to diabetic animals inhibits lesions of the retinopathy [55].
PBM imparts significant anti-oxidant benefits in retinas of diabetic albino rats and in pigmented mice. Whether this is mediated via direct or indirect mechanisms is not known, but it is clear that increased retinal oxidative stress is a major contributor to the pathogenesis of diabetic retinopathy. Recent studies suggest that this oxidative stress is generated in large part by rod cells [24]. Oxidative stress is a known modulator of calcium channel function [56], so we assessed effects of PBM on diabetes-induced alterations in retinal ion movement using MEMRI. Previous studies have shown that the diabetes-induced impairment in intraretinal manganese uptake are corrected by antioxidants (including lipoic acid and targeted overexpression of peroxisomal catalase) or overexpression of the antioxidant enzyme, superoxide dismutase [33,57]. We now show that PBM improves both inner and outer retinal uptake of manganese, consistent with the hypothesis that retinal oxidative stress in diabetes impairs ion channel function, and that mitigation of the ion channel defects by PBM occurs secondary to inhibition of the oxidative stress. How PBM affects calcium channel function is unclear at present.
HO-1 is a highly inducible enzyme that mediates cytoprotective responses to toxic insults, including inflammation and oxidative stress. The enzyme or its products have important cardiovascular protective effects, such as vasodilator, anti-inflammatory, antihypertensive, antioxidant and anti-apoptotic actions [58–61]. To determine if HO-1 played a role in the observed beneficial effects of PBM in retinas of diabetic animals, some diabetics treated with PBM were also given the HO-1 inhibitor, SnPP, with the expectation that parameters made worse by the inclusion of the HO-1 inhibitor would indicate possible roles of HO-1 in beneficial effects of PBM. Compared to diabetics with PBM alone, leukostasis was greatly exacerbated in retinal vessels of diabetics treated with PBM and SNPP, suggesting that HO-1 acts to mitigate the leukostasis in diabetes. Since (i) leukostasis involves binding of an activated leukocyte to an adhesion molecule (like ICAM-1), and (ii) SnPP did not alter the beneficial effect of PBM on ICAM-1 expression, these results imply that the effects of SnPP on leukostasis are mediated within the leukocytes. Likewise, SnPP inhibited the diabetes-induced reduction in HO-1 expression, apparently acting on a feed-back mechanism. Inhibition of HO-1 during PBM suppressed the diabetes-induced induction of iNOS expression better than that observed with PBM alone, suggesting that HO-1 activity somehow is involved in regulation of iNOS expression in diabetes.
Beneficial effects of PBM occur despite pigmentation, and are apparent when administered from either the onset of diabetes (prevention) [18] or after a period of untreated diabetes (intervention; present study and [17]). These findings provide evidence of beneficial actions of far-red light on important early changes of diabetic retinopathy, and show that PBM can inhibit development of diabetes-induced molecular abnormalities in the retina, as well as mitigating existing abnormalities. PBM is non-invasive, inexpensive, and easily to administer, and offers a non-pharmacologic approach to help inhibit lesions of diabetic retinopathy. Importantly, the beneficial effects are apparent with exposure to the light for only a few minutes per day.
Funding Statement
This work was supported by grants from the National Eye Institute (EY00300, EY022938, R24EY024864 to TSK and EY021619 to BAB), the Medical Research Service of the Department of Veteran Affairs (TSK), and the Brazilian Institution CAPES (AS). Support was also provided by the CWRU Visual Science Research Center core facility (P30EY11373), and Research to Prevent Blindness to Kresge Eye Institute (BAB).
Data Availability
All relevant data are within the paper.
References
Pre-exposure to low-power diode laser irradiation promotes cytoprotection in the rat retina.
1Ophthalmology Department, Ruijin Hospital, Shanghai JiaoTong University, Shanghai, 200025, China.
The aim of this study was to investigate whether pre-exposure to low-power laser irradiation can provoke an effect on cellular protection in the rat retina. The right eyes of 40 rats were exposed to a 3-mm diode laser beam for 1 min in different light intensities and different experimental sets: group A low power of 60 mW (34.27 J/cm(2) on the retina in consideration of the energy losses along the optical pathway) prior to high power of 80 mW (44.88 J/cm(2) on the retina in consideration of the energy losses along the optical pathway), group B high power, group C low power, group D (the left eyes from the counterpart of group A) and group E (untreated rat eyes) as controls. Morphological retinal change retinas were assessed using light microscopy and/or transmission electron microscopy. Heat shock protein (Hsp) 70 and cleaved caspase 3 protein expression were analyzed by immunohistochemical staining and Western blot. Cellular injury was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay. Hsp 70 expression in the inner plexiform layer and the outer plexiform layer in group A were 73.09?±?6.49 and 78.03?±?3.05%, respectively, which was significantly higher (P?<?0.05) than those observed in group B (59.07?±?1.40 and 32.25?±?4.26%, respectively). The Hsp70/?-actin ratio was 0.49?±?0.06 in group C, which was significantly higher (P?<?0.05) than that of group B (0.27?±?0.04). Cleaved caspase 3 expression in group C both was significantly lower than that observed in group B. TUNEL staining showed that positive cells in the outer nuclear layer and inner nuclear layer in group A were significantly lower than those of group B. Pre-exposure to a 60-mW (34.27 J/cm(2) on the retina) power laser irradiation stimulates a hyperexpression of Hsp70 together with a hypoexpression of cleaved caspase 3 in rat retina, which may suggest a cellular protective effect.
Photobiomodulation with 670 nm light increased phagocytosis in human retinal pigment epithelial cells

Abstract
Purpose
Photobiomodulation is the treatment with light in the far-red to near-infrared region of the spectrum and has been reported to have beneficial effects in various animal models of disease, including an age-related macular degeneration (AMD) mouse model. Previous reports have suggested that phagocytosis is reduced by age-related increased oxidative stress in AMD. Therefore, we investigated whether photobiomodulation improves phagocytosis caused by oxidative stress in the human retinal pigment epithelial (ARPE-19) cell line.
Methods
ARPE-19 cells and human primary retinal pigment epithelium (hRPE) cells were incubated and irradiated with near-infrared light (670 nm LED light, 2,500 lx, twice a day, 250 s/per time) for 4 d. Next, hydrogen peroxide (H2O2) and photoreceptor outer segments (POS) labeled using a pH-sensitive fluorescent dye were added to the cell culture, and phagocytosis was evaluated by measuring the fluorescence intensity. Furthermore, cell death was observed by double staining with Hoechst33342 and propidium iodide after photobiomodulation. CM-H2DCFDA, JC-1 dye, and CCK-8 were added to the cell culture to investigate the reactive oxygen species (ROS) production, mitochondrial membrane potential, and cell viability, respectively. We also investigated the expression of phagocytosis-related proteins, such as focal adhesion kinase (FAK) and Mer tyrosine kinase (MerTK).
Results
Oxidative stress inhibited phagocytosis, and photobiomodulation increased the oxidative stress-induced hypoactivity of phagocytosis in ARPE-19 cells and hRPE cells. Furthermore, H2O2 and photobiomodulation did not affect cell death in this experimental condition. Photobiomodulation reduced ROS production but did not affect cell viability or mitochondrial membrane potential. The expression of phosphorylated MerTK increased, but phosphorylated FAK was not affected by photobiomodulation.
Conclusions
These findings indicate that near-infrared light photobiomodulation (670 nm) may be a noninvasive, inexpensive, and easy adjunctive therapy to help inhibit the development of ocular diseases induced by the activation of phagocytosis.
Introduction
Age-related macular degeneration (AMD) is a progressive and degenerative eye disease that is a common cause of vision loss in developed countries [1]. AMD is classified into dry and wet types, and the main clinical feature common to both is the accumulation of lipofuscin in retinal pigment epithelium (RPE) cells. Wet AMD is characterized by abnormal angiogenesis, and dry AMD is characterized by atrophy of the outer retinal layers and RPE cells [2,3]. Risk factors for AMD, such as aging, light damage, smoking, genetic factors, and oxidative stress, have been reported to cause the accumulation of lipofuscin [4].
RPE cells help maintain the normal functions of photoreceptor cells by playing a role in phagocytosis, a part of the visual cycle, by forming a blood–retinal barrier that permits the exchange of waste products and nutrients between the blood and the retina [5,6]. Phagocytosis by RPE cells is an essential function of homeostasis in the retina. Photoreceptor cells are damaged by exposure to light. RPE cells can remove deteriorated photoreceptor outer segments (POS) via phagocytosis to preserve the function of photoreceptor cells [7]. It is important that the phagocytosis of RPE cells is not inhibited because the dysfunction of phagocytosis can trigger RPE damage and lysosomal disorder that prevents the breakdown of waste products, ultimately resulting in the accumulation of lipofuscin [8,9]. Thus, we believe the inhibition of lipofuscin accumulation is likely to improve AMD [10]. Phagocytosis of POS by RPE cells involves several steps, such as binding, uptake, and degradation, and each step is regulated by some proteins. Phagocytosis of POS by RPE cells requires ?v?5 integrin for binding [11]. Focal adhesion kinase (FAK) is a cytoplasmic protein tyrosine kinase and is phosphorylated by integrin engagement. Finnemann et al. have shown that POS binding by RPE cells increases FAK complex formation with ?v?5 integrin and activates FAK [11,12]. FAK is related to the binding of POS, whereas Mer tyrosine kinase (MerTK) is not required for binding but for internalization [12,13]. Rat RPE cells expressing MerTK can bind to the surface of RPE cells but have no effect on the internalization of POS [14].
The AMD models were appeared to mitochondrial dysfunction. The accumulation of lipofuscin decreased the mitochondrial membrane potential, impaired oxidative phosphorylation in the mitochondrial respiratory chain, and decreased the activity of phagocytosis [15].
Previous reports have shown that photobiomodulation, treatment with light in the far-red to near-infrared region of the spectrum, is beneficial in treating strokes, wounds, infection, diabetic retinopathy, and AMD [16–19]. Its beneficial effects include regulating cell viability by absorbing near infrared light in photosensitive molecules such as water, melanin, hemoglobin, and cytochrome c oxidase molecules. Some of the most important photosensitive molecules that respond to photobiomodulation are cytochrome c oxidase molecules, which accept electrons and are involved in producing adenosine triphosphate (ATP) in mitochondrial oxidative phosphorylation [20]. It is known that photobiomodulation activates cytochrome coxidase and increases cellular ATP, resulting in the protection of neurons [21]. It has been reported that photobiomodulation suppresses the inflammation caused by decreased mitochondrial activity [16]. Other reports have suggested that photobiomodulation increases the expression of the antioxidant enzyme MnSOD without affecting cytochrome c oxidase activity (which is related to mitochondrial activity); thus, the mechanism of photobiomodulation effects is not clear [17]. However, it is well known that photobiomodulation has effects such as the upregulation of ATP, the increase of antioxidant materials, and the prevention of inflammation in retinal neurons [17,22,23]. However, the effect of photobiomodulation on phagocytosis in RPE cells remains unclear. In the present study, we therefore investigated the effect of photobiomodulation on the oxidative stress-induced hypoactivity of phagocytes in ARPE-19 cells and primary human RPE (hRPE) cells.
Methods
Cell culture
The human retinal pigment epithelial cell line (ARPE-19) was obtained from American Type Culture Collection (Manassas, VA). The cells were maintained in Dulbecco’s Modified Eagle’s medium (DMEM)/F-12 (Wako, Osaka, Japan) containing 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 ?g/ml streptomycin. Cultures were maintained at 37 °C in a humidified atmosphere of 95% air and 5% CO2. The ARPE-19 cells were passaged by trypsinization every 3–4 d.
The primary hRPE cells were obtained from Lonza (Walkersville, MD). The cells were maintained in Retinal Pigment Epithelial Basal Medium (Lonza) containing 2% FBS, 4 mL L-glutamine (Lonza), 0.2 ml GA-1000 (Lonza), and 1 mL growth factor (FGF-B; Lonza) according to the manufacturer’s protocol. Cultures were maintained at 37 °C in a humidified atmosphere of 95% air and 5% CO2. The cells were passaged by Trypsin/EDTA (Lonza), Trypsin Neutralizing Solution (Lonza), and HEPES Buffered Saline Solution (Lonza) every 3–4 d.
Isolation from porcine eyes and labeling of photoreceptor outer segments
Retinas from freshly obtained porcine eyes were homogenized with POS buffer (115 mM NaCl, 2.5 mM KCl, 1 mM MgCl2, 10 mM HEPES/KOH ph 7.5, and 1 mM dithiothreitol) containing 1.5 mM sucrose on ice. The suspension was centrifuged for 7 min at 7,510 ×g to sediment chunk pieces of retinas. A filter (BD Falcon, Franklin Lakes, NJ) was used to remove the deposits, and the filtrate was diluted with POS buffer and centrifuged again. The pellet was diluted with POS buffer containing 0.6 mM sucrose. The suspension was then added to the tube containing the continuous sucrose gradient and the whole was centrifuged for 90 min at 103,700 ×g in RP55T rotor (Hitachi Co., Ltd. Tokyo, Japan). After centrifugation, POS bands were collected and diluted with 1:3 balanced salt solution (BSS; 10 mM HEDES, 137 mM NaCl, 5.36 mM KCl, 0.81 mM MgSO4, 1.27 mM CaCl2, 0.34 mM Na2HPO4, and 0.44 mM KH2PO4). This was suspended for 7 min at 7,510 ×g to obtain a pure POS pellet, which was then stored in darkness at ?80 °C. The supernatant was removed and the POS was taken up in several milliliters of POS buffer. The media were concentrated by centrifugation at 4,000 ×g using an Amicon Ultra-15 centrifugal filter device (Millipore, Billerica, MA; molecular weight cutoff: 3,000) to combine POS with pHrodo. Unlabeled POS (5 × 107) were added to 5 mL of the BSS. POS were labeled at a final concentration of 1 mg pHrodo/10 mg protein. POS with the dye were concentrated by centrifugation at 4,000 ×g using the Amicon Ultra-15 centrifugal filter device (Millipore; molecular weight cutoff: 3,000) for 6 h at 4 °C [24].
Near-infrared photobiomodulation
For all experiments, we followed this protocol before each assay: ARPE-19 cells were plated at a density of 1.5 × 104 cells per well with DMEM/F-12 containing 10% FBS in 96-well plates. This was incubated for 4 d with or without 670 nm light emitting diode (LED; Sawa Denshi Kougyou, Saitama, Japan) treatment (250 s at 3.89 mW/cm2 twice/day). The medium was changed to DMEM/F12 containing 1% FBS, and the cells were treated with an antioxidant, N-acetylcysteine (NAC; Sigma-Aldrich, St. Louis, MO) for 1 h.
Phagocytosis assays
H2O2 at a final concentration of 0.1 mM and 1 × 105 POS/well were added to each well and incubated for 6 h. The cells were then washed five times with 1% FBS DMEM/F-12 to allow removal of non-specific POS binding to quantify specific attachement of POS by RPE cells. Images were collected using a fluorescence microscope (BZ-9000; Keyence, Osaka, Japan) and then quantified using image processing software (Image-J, ver. 1.43 h; National Institutes of Health, Bethesda, MD). The area was then calculated.
Nuclear staining assay
Nuclear staining assays were conducted 6 h after H2O2 treatment.
Cell viability assay
Water-soluble tetrazolium salt 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-disulfophenyl)-2H-tetrazolium monosodium salt (WST-8) assay kits were used to investigate the inhibitory effect of photobiomodulation on oxidative stress-induced cytotoxicity. Briefly, 10 ?l of CCK-8 (Dojindo Laboratories, Kumamoto, Japan) was added to each well, and the cells were incubated at 37 °C for 2 h. The absorbance was measured at 492 nm (reference wavelength, 660 nm) using SkanIt Re for Varioskan Flash 2.4 (ThermoFisher Scientific Inc., Waltham, MA).
Measurement of intracellular reactive oxygen species production
The measurement of intracellular reactive oxygen species (ROS) production was estimated by CM-H2DCFDA (Invitrogen). Briefly, CM-H2DCFDA was added to the medium at a final concentration of 10 ?M, followed by incubation at 37 °C for 1 h. Fluorescence was then measured using a fluorescence spectrophotometer at 488 nm excitation and 525 nm emission.
Mitochondrial membrane potential assay
The measurement of mitochondrial membrane potential was estimated using JC-1 dye (Mitochondrial Membrane Potential Probe; Invitrogen). The ARPE-19 cells (1.5 × 104 cells/well) were cultured and exposed to H2O2 for 6 h. The cells were washed and incubated with 10 ?g/ml JC-1 at 37 °C for 15 min in the dark. Images were collected using a fluorescence microscope (BZ-9000; Keyence), which detects healthy cells with JC-1 J-aggregates (excitation/emission=540/605 nm) and unhealthy cells with mostly JC-1 monomers (excitation/emission=480/510 nm).
Western blot analysis
The ARPE-19 or hRPE cells (1.5 × 104 cells/well) were seeded onto a 24-well plate and cultured at 37 °C for 4 d. After H2O2 exposure, the cells were supplemented with a 1% protease inhibitor cocktail (Sigma), 1% phosphate inhibitor cocktails 2 and 3 (Sigma), and sample buffer (Wako). The lysate was centrifuged at 12,000 ×g for 10 min, and the supernatant was collected for analysis. Protein concentration was determined using a BCA protein assay kit (Pierce Biotechnology, Rockford, IL) with BSA as standard. An equal volume of protein sample and sample buffer with 10% 2-mercaptoethanol was electrophoresed with a 10% sodium dodecyl sulfate-polyacrylamide gel, and the separated proteins were then transferred onto a polyvinylidene difluoride membrane (Immobilon-P; Millipore). The following primary antibodies were used for immunoblotting: anti-MerTK (phospho Y749 + Y 753 + Y754; ab14921) rabbit polyclonal antibody (1: 500; abcam); anti-MerTK (ab137673) rabbit polyclonal antibody; anti-phospho-FAK (Tyr397) rabbit polyclonal antibody (1: 1000; Cell Signaling Technology, Danvers, MA); anti-FAK (C-903; sc-932) rabbit polyclonal antibody (1:1000; Santa Cruz Biotechnology, Inc. CA), and anti-?-actin mouse monoclonal antibody (1:5000; Sigma). An HRP-conjugated goat anti-rabbit antibody and an HRP-conjugated goat anti-mouse antibody (1:2000) were used as secondary antibodies. Band densities were measured using an imaging analyzer (LAS-4000 mini, Fujifilm, Tokyo, Japan), gel analysis software (Image Reader LAS-4000; Fujifilm), and detected band analysis software (Multi Gauge; Fujifilm).
Statistical analysis
Data are presented as the mean ± standard error of the mean (SEM). Statistical comparisons were made using a two-tailed paired Student t test only, where p<0.05 indicated statistical significance.
Results
Photobiomodulation enhanced the phagocytic activity in oxidative stress
To clarify the effect on phagocytic activity in near-infrared light-exposed ARPE-19 cells, the phagocytic activity in the cells was investigated after 6 h of H2O2 exposure by measuring the fluorescence intensity of intracellular POS. The quantification of fluorescence intensity was calculated as described in the Methods section. The fluorescence intensity was significantly reduced after H2O2 exposure, and NAC, an antioxidant, increased the fluorescence intensity. Moreover, photobiomodulation enhanced the fluorescence intensity of intracellular POS in comparison to the group that was only exposed to H2O2 (Figure 1 B,C). The group exposed to H2O2 and NAC group maybe also invreased the fluorescence intensity but we did not use statistical analysis between H2O2 only group and H2O2/NAC group. H2O2 or photobiomodulation did not affect cell death in this experimental condition (Figure 1D).
Photobiomodulation did not affect cell viability or mitochondrial membrane potential but reduced reactive oxygen species production
Cell viability was determined by WST-8 assay in order to clarify the other effects of photobiomodulation in ARPE-19 cells. In the group exposed only to H2O2, cell viability was reduced for 6 h compared to the control group with a reduction of 21%. Photobiomodulation did not affect cell viability (Figure 2A). CM-H2DCFH is converted to a fluorescent product (CM-H2DCF) when intracellular ROS are produced, was increased by H2O2 exposure, and 1 mM NAC significantly reduced the oxidative stress-induced ROS production in ARPE-19 cells. Daily exposure to 250 s of 670 nm photobiomodulation significantly inhibited the H2O2-induced ROS production (Figure 2B). To investigate the effect of photobiomodulation on mitochondrial activity, JC-1 dye was used. Neither H2O2 nor photobiomodulation significantly changed the red or green fluorescence (Figure 2C)
Photobiomodulation increased the expression of phosphorylated MerTk but did not change the expression of phosphorylated FAK
We investigated the mechanism of the promotion of phagocytosis by photobiomodulation. We tested changes in the levels of phagocytosis-associated proteins, FAK and MerTK, by western blot analysis after 3 h or 6 h of H2O2 exposure to clarify the mechanism of phagocytosis. The maximum reduction of p-FAK and p-MerTK expression was observed 3 h and 6 h after H2O2 exposure, respectively (data not shown). Phosphorylated FAK was significantly reduced by H2O2 treatment, but photobiomodulation did not change the expression of FAK in comparison to the H2O2-exposed group (Figure 3A). In this point, we performed the statistical analysis between H2O2 only treated group and photobimodulation group. Although photobiomodulation did not change the expression of phosphorylated FAK, photobiomodulation improved the reduction of phosphorylated MerTK induced by the oxidative stress (Figure 3B). NAC at 1 nM increased the expression of phosphorylated FAK and MerTK.
Photobiomodulation enhanced the phagocytic activity and increased the expression of phosphorylated MerTK
We investigated the phagocytosis activity and the expression of phosphorylated MerTK to validate our results concerning ARPE-19. The fluorescence intensity was significantly reduced after H2O2 exposure, and photobiomodulation enhanced the fluorescence intensity of intracellular POS in hRPE cells in comparison to the H2O2 only group (Figure 4A). In this point, we performed the statistical analysis between H2O2 only treated group and photobimodulation group. Furthermore, we investigated the expression of phosphorylated MerTK in hRPE cells. The expression of phosphorylated MerTK was increased in primary RPE cultures by photobiomodulation (Figure 4B).
Discussion
In the present study, as expected, phagocytic activity was reduced by exposure to H2O2 (Figure 1). The activity of RPE cells is reduced by oxidative stress and the auto-oxidative lipofuscin is accumulated in the lysosomes. In addition, drusen is formed in between the RPE and Bruch’s membrane. Ultimately, these things result in AMD [25,26]. The increase of oxidative stress also impairs the function of phagocytosis, and the dysfunction of phagocytosis induces the accumulation of lipofuscin [27,28].
Next, we investigated whether photobiomodulation using low-intensity and near-infrared light affects ARPE-19. Blue LED is routinely used in video display terminals and is known as an inducer of several kinds of photoreceptor cell damage in our laboratory [29]. In contrast, red LED has longer wavelengths than blue LED and has a protective effect on photoreceptors [22].
Near-infrared light photobiomodulation has a protective effect against light-induced retinal degeneration and reduced inflammation via the upregulation of mitochondrial cytochrome c oxidase expression in AMD mouse models [16,22]. Although photobiomodulation reduced the ROS production, it did not alter the cell viability or mitochondrial membrane potential (Figure 2). A previous report suggested that photobiomodulation has protective effects against high glucose-induced cell death of 661W cells (mouse photoreceptor cells) and retinal ganglion cells but not against high glucose-induced cell death of ARPE-19 cells [17]. This report also indicated that all cell lines, including ARPE-19, reduced the superoxide generation but did not change cytochrome c oxidase activity, which is related to mitochondrial activity. Furthermore, this phagocytosis assay model was set in a concentration of 0.1 mM H2O2, which did not change the cell death rate. Thus, low-intensity far-red light have no effects on cell viability or mitochondrial membrane potential.
Phagocytosis is related to FAK and MerTK expression. MerTK is an important protein in the ingestion of POS, and it has been shown that mutation of MerTK found in retinitis pigmentosa—one of the most common retinal diseases responsible for blindness—results in phagocytic dysfunction in RPE cells [30,31]. In the present study, we investigated the expression and phosphorylation of FAK and MerTK in POS exposed ARPE-19 cells to clarify the mechanism of phagocytosis enhancement with near-infrared photobiomodulation. Photobiomodulation increased phosphorylated MerTK but not phosphorylated FAK. Although photobiomodulation increased only the phosphorylated MerTK, the antioxidant NAC increased both phosphorylated FAK and MerTK. There are some difference pathway to increase the phagocytosis activity between photobiomodulation and antioxidant. A previous report suggested that mitochondrial dysfunction impairs the function of phagocytosis in retinal pigment epithelial cells [15]. Photobiomodulation may have a specific effect, which is the upregulation of phagocytosis activity through some mitochondrial pathways.
In conclusion, these findings indicate that photobiomodulation enhances phagocytosis via the MerTK-mediated upregulation of POS ingestion into RPE cells (Figure 5). Near-infrared light photobiomodulation may be a noninvasive, inexpensive, and easy adjunctive therapy to help inhibit the development of ocular diseases, such as AMD and retinitis pigmentosa. However, further experimentation and clinical studies are needed to clarify the therapeutic effects.
References
Photobiomodulation Mitigates Diabetes-Induced Retinopathy by Direct and Indirect Mechanisms: Evidence from Intervention Studies in Pigmented Mice.
Author information
1Case Western Reserve University, Cleveland, Ohio, United States of America; Catholic University of Brasilia, Brasilia, Brazil.
2Case Western Reserve University, Cleveland, Ohio, United States of America.
3Department of Anatomy and Cell Biology, Wayne State University, Detroit, Michigan, United States of America.
4Department of Anatomy and Cell Biology, Wayne State University, Detroit, Michigan, United States of America; Department of Ophthalmology, Wayne State University, Detroit, Michigan, United States of America.
5Case Western Reserve University, Cleveland, Ohio, United States of America; Cleveland Veteran’s Affairs Medical Center, Research Service 151, Cleveland, Ohio, United States of America.
OBJECTIVE:
Daily application of far-red light from the onset of diabetes mitigated diabetes-induced abnormalities in retinas of albino rats. Here, we test the hypothesis that photobiomodulation (PBM) is effective in diabetic, pigmented mice, even when delayed until weeks after onset of diabetes. Direct and indirect effects of PBM on the retina also were studied.
Diabetes was induced in C57Bl/6J mice using streptozotocin. Some diabetics were exposed to PBM therapy (4 min/day; 670 nm) daily. In one study, mice were diabetic for 4 weeks before initiation of PBM for an additional 10 weeks. Retinal oxidative stress, inflammation, and retinal function were measured. In some mice, heads were covered with a lead shield during PBM to prevent direct illumination of the eye, or animals were treated with an inhibitor of heme oxygenase-1. In a second study, PBM was initiated immediately after onset of diabetes, and administered daily for 2 months. These mice were examined using manganese-enhanced MRI to assess effects of PBM on transretinal calcium channel function in vivo.
PBM intervention improved diabetes-induced changes in superoxide generation, leukostasis, expression of ICAM-1, and visual performance. PBM acted in part remotely from the retina because the beneficial effects were achieved even with the head shielded from the light therapy, and because leukocyte-mediated cytotoxicity of retinal endothelial cells was less in diabetics treated with PBM. SnPP+PBM significantly reduced iNOS expression compared to PBM alone, but significantly exacerbated leukostasis. In study 2, PBM largely mitigated diabetes-induced retinal calcium channel dysfunction in all retinal layers.
PBM induces retinal protection against abnormalities induced by diabetes in pigmented animals, and even as an intervention. Beneficial effects on the retina likely are mediated by both direct and indirect mechanisms. PBM is a novel non-pharmacologic treatment strategy to inhibit early changes of diabetic retinopathy.
Combining Neuroprotectants in a Model of Retinal Degeneration: No Additive Benefit.
Di Marco F1, Di Paolo M1, Romeo S1, Colecchi L1, Fiorani L1, Spana S2, Stone J3, Bisti S4.
Author information
- 1Department of Biotechnology and Applied Clinical Science, University of L’Aquila, L’Aquila, Italy.
- 2Discipline of Physiology and Bosch Institute, University of Sydney, Sydney, New South Wales, Australia.
- 3Discipline of Physiology and Bosch Institute, University of Sydney, Sydney, New South Wales, Australia; ARC Centre of Excellence in Vision Science, The Australian National University, Canberra, Australia.
- 4Department of Biotechnology and Applied Clinical Science, University of L’Aquila, L’Aquila, Italy; ARC Centre of Excellence in Vision Science, The Australian National University, Canberra, Australia.
- Abstract
The central nervous system undergoing degeneration can be stabilized, and in some models can be restored to function, by neuroprotective treatments. Photobiomodulation (PBM) and dietary saffron are distinctive as neuroprotectants in that they upregulate protective mechanisms, without causing measurable tissue damage. This study reports a first attempt to combine the actions of PBM and saffron. Our working hypothesis was that the actions of PBM and saffron in protecting retinal photoreceptors, in a rat light damage model, would be additive. Results confirmed the neuroprotective potential of each used separately, but gave no evidence that their effects are additive. Detailed analysis suggests that there is actually a negative interaction between PBM and saffron when given simultaneously, with a consequent reduction of the neuroprotection. Specific testing will be required to understand the mechanisms involved and to establish whether there is clinical potential in combining neuroprotectants, to improve the quality of life of people affected by retinal pathology, such as age-related macular degeneration, the major cause of blindness and visual impairment in older adults.
Br J Ophthalmol 2014 Mar 28. doi: 10.1136/bjophthalmol-2013-304477. [Epub ahead of print]
Photobiomodulation in the treatment of patients with non-center-involving diabetic macular oedema.
Tang J, Herda AA, Kern TS.
Abstract
PURPOSE:
Far-red/near-infrared phototherapy or photobiomodulation (PBM) has recently been reported to be an effective and non-invasive treatment method to inhibit lesions of diabetic retinopathy (DR) in animals. This study investigated the safety and efficacy of PBM in diabetic patients to treat non-center-involving diabetic macular oedema (NCDME).
METHODS:
This was a non-randomised, consecutive, case series, where 4 patients with type 2 diabetes with NCDME were treated for 160 s per day with PBM for 2-9 months. Demographic data including age, sex, HbA1c%, electronic ETDRS visual acuity, and retinal and macular thickness were measured using spectral domain ocular coherence tomography (SD-OCT) before and after treatment.
RESULTS:
Four eyes of 4 patients were treated, with fellow eyes serving as untreated controls. Daily PBM treatment for only 80 s per treatment twice daily caused a significant reduction in focal retinal thickening in all 4 treated eyes. No adverse effects attributable to therapy were noted by the patients or study investigators during the study period.
CONCLUSIONS:
PBM potentially offers a non-invasive and cost-effective therapeutic option for patients with NCDME. Further studies of this therapeutic option in DR are warranted.
Red/near-infrared irradiation therapy for treatment of central nervous system injuries and disorders.
- 1School of Animal Biology, The University of Western Australia, Crawley, Australia. lindy.fitzgerald@uwa.edu.au
Abstract
Irradiation in the red/near-infrared spectrum (R/NIR, 630-1000 nm) has been used to treat a wide range of clinical conditions, including disorders of the central nervous system (CNS), with several clinical trials currently underway for stroke and macular degeneration. However, R/NIR irradiation therapy (R/NIR-IT) has not been widely adopted in clinical practice for CNS injury or disease for a number of reasons, which include the following. The mechanism/s of action and implications of penetration have not been thoroughly addressed. The large range of treatment intensities, wavelengths and devices that have been assessed make comparisons difficult, and a consensus paradigm for treatment has not yet emerged. Furthermore, the lack of consistent positive outcomes in randomised controlled trials, perhaps due to sub-optimal treatment regimens, has contributed to scepticism. This review provides a balanced précis of outcomes described in the literature regarding treatment modalities and efficacy of R/NIR-IT for injury and disease in the CNS. We have addressed the important issues of specification of treatment parameters, penetration of R/NIR irradiation to CNS tissues and mechanism/s, and provided the necessary detail to demonstrate the potential of R/NIR-IT for the treatment of retinal degeneration, damage to white matter tracts of the CNS, stroke and Parkinson’s disease.
Treatment with 670 nm Light Up Regulates Cytochrome C Oxidase Expression and Reduces Inflammation in an Age-Related Macular Degeneration Model
Conceived and designed the experiments: CH GJ. Performed the experiments: RB MBP NH. Analyzed the data: RB MBP NH. Contributed reagents/materials/analysis tools: GJ NH. Wrote the paper: RB GJ.
Introduction
Progressive ageing is associated with systemic inflammation [1]–[3]. This is marked in tissues with high metabolic demand such as the retina that suffers from progressive oxidative stress [4]–[6]. This is partly driven by excess extra-cellular deposition along an ageing Bruch’s membrane, where inflammation becomes a key feature, even in the absence of pathology [2], [7]. It is also a common feature of retinal disease whether it be age related macular degeneration (AMD), diabetic retinopathy or posterior uveitis [8]–[12]. Ameliorating retinal inflammation is becoming a key problem with an ageing population as this may be associated with age related retinal cell loss and declining visual function [13]–[15]. It is also critical in many retinal diseases [5], [10], [11].
There are multiple routes to dealing with retinal inflammation, however key to any success is the need for cheap effective therapies that are minimally invasive and do not require clinical time. Inflammation is partially driven by shifts in mitochondrial function that result in reduced adenosine triphosphate (ATP) production and increased reactive oxygen species (ROS) output [5], [7], [16]. This can be modulated by brief exposure to 670 nm light, which is absorbed by cytochrome c oxidase (COX) and increases ATP production [17], [18]. This has been shown to reduce a range of retinal inflammatory markers in normal aged mice when directly exposed to the light for brief periods [7]. It has also been used effectively to reduce damage from experimental pathology in a wide range of independent studies (see Table 1 in ref 7).
Here we ask two questions. First, is 670 nm light a potential therapeutic route in an aged mouse model of AMD? Half of AMD cases are associated with polymorphisms of the complement system including complement factor H (CFH) [19]–[21]. There is a mouse model of CFH?/? that has a distinct retinal phenotype with outer retinal disorganisation, elevated inflammation and reduced retinal function [22]–[24]that we employ here. Second, in previous studies using 670 nm light, animals have been held individually directly in front of the light source [7], [25]. Here we also ask whether 670 nm is therapeutic when given for short periods indirectly as part of the environmental lighting when animals are caged in groups and their retinae are not forcibly exposed to it individually. With both of these questions our analysis is focussed primarily on the outer retina, which is the location for disease initiation and progression in AMD, both in humans and in the mouse model [26]–[28].
Materials and Methods
Animals-ethics Statement
Twenty nine 16 month old CFH?/? mice were used. Thirty nine eyes from these animals were used in different procedures (Table 1). Mice had been maintained from birth in a normal animal unit with a 1212 light cycle. None of the animals were exposed to direct lighting. All animals were used with University College London ethics committee approval and under a UK Home Office project licence (PPL 70/7036). All procedures were conducted in accordance to the United Kingdom Animal Scientific Procedures Act 1986.
Therapeutic Light Treatment and Control
The aged mice were divided randomly into two groups. These were caged separately for 14 days in adjacent compartments of a large animal cabinet. Individual cages had an internal space of 6,422 cubic centimeters, with a maximum of five animals per cage. The external walls of the cage were sprayed matt white to increase internal reflectance (Figure 1). All were exposed to low levels of room illumination on a 1212 L/D pattern of approximately 50 Lux.
The spectrum of the room illumination was measured at 0.5 m below the light source and within the cage with an Ocean Optics (USB2000+UV-VIS-ES, Dunedin, USA), showing minimal 670 nm content (Figure 2). Room illumination was indirect. The experimental group were exposed to 670 nm light via LED sources (C.H. Electronics, UK) behind clear perspex screens at either end of the cage (Figure 1). Spectral (Ocean Optics) and intensity measurements with a radiometer (International Lights, IL 1700 SED033IF/W, Massachusetts, USA) were made directly in front of the source and behind the perspex screens. There was no spectral shift as a consequence of the perspex screen and only vary minimal attenuation in intensity.
Energy levels for 670 nm and room lighting at different parts of the cage are given in Table 2. Each source produced 20 mW/cm2 and was turned on automatically for 6 minutes at approximately 6 am and 6 pm each day for 14 days. No attempt was made to modify the animal’s behaviour during exposures. The control group were housed separately, under identical conditions and could not see the 670 nm lights.
Following 14 days of light exposure all animals were killed by cervical dislocation and their eyes removed. Those for immunohistochemistry were fixed for 1 hour in 4% paraformaldehyde in phosphate buffered saline (PBS, pH 7.2) at room temperature, followed by X3 washes with PBS. Those for Quantitative real-time polymerase chain reaction (qPCR) and for Western blots were chilled on ice. Immunostaining was undertaken for a range of markers including COX, ionized calcium-binding adaptor molecule 1 (IBA-1), complement component C3, vimetin, glial fibrillary acidic protein (GFAP) and amyloid beta (A?). qPCR was used to confirm key COX and C3 labelling. Western blot analysis was undertaken additionally to confirm COX labelling as this is fundamental to the mode of action of 670 nm light.
Immunostaining- Outer Retinal Macrophages
To examine the morphology of outer retinal macrophages flat mounts were stained with IBA-1. Eyes were dissected and flat mounts of the retinal pigmented epithelial (RPE) surface were produced following method used by Hoh Kam et al [2]. These were washed with PBS X1 for 5 minutes and blocked with 5% Normal Donkey Serum (NDS) in 3% Triton X-100 PBS for 2 hours on shaker. Followed by X1 wash with PBS and a primary antibody solution prepared by diluting 1% NDS in 3% Triton X-100 and incubated with IBA-1 (rabbit polyclonal, 11000, A. Menarini Diagnostics, Wokingham, UK) overnight to mark macrophages. Next day the tissue was washed X3 with PBS and a secondary antibody solution prepared by diluting 2% NDS in 0.3% Triton X-100, incubated with donkey-anti rabbit 488 (1
2000, Invitrogen, Paisley, UK) for 2 hours. Tissues were washed X3 with PBS then incubated with 4?,6-diamidino-2-phenylindole (DAPI, 1
5000, Sigma Aldrich, Dorset, UK) for 1 minute in the dark to provide a counter stain. Lastly, tissues were washed several times with PBS and Tris buffered saline (TBS). The RPE flat mounts were mounted with Vectrashield (Vector laboratories, Peterborough, UK), cover slipped and sealed with nail varnish.
Immunostaining- Sections
Fixed eyes were cryo-protected in 30% sucrose in PBS and embedded in optimal cutting temperature compound (OCT, Agar scientific, Stanstead, UK). Eyes were sectioned at 10 µm and thaw-mounted onto charged slides overnight. Immunohistochemistry was performed according to Hoh Kam et al [2]. Sections were initially washed for 5 minutes with PBS and then blocked with 5% NDS in 0.3% Triton X-100 solution for 1 hour. These were washed briefly and then a primary antibody solution was prepared by diluting 1% NDS in 0.3% Triton X-100 and incubated overnight. The following day, this was washed 1X with PBS, and a secondary antibody solution was prepared as described above and incubated for 1 hour. After incubation, this was washed several times and then DAPI was applied for 1 minute as a counter stain. Sections were then washed with PBS and TBS, mounted, cover slipped and sealed as described above. The following primary antibodies were used: COX subunit VIb (rabbit monoclonal 1200, Abcam, Cambridge, UK), C3 (rabbit polyclonal 1
20, Abcam, Cambridge, UK), vimentin (rabbit monoclonal 1
100, Abcam, Cambridge, UK), GFAP (mouse monoclonal 1
1000, Abcam, Cambridge, UK) and A? (mouse monoclonal 1
500, Covance, UK). This was followed by incubation with the appropriate Alexa fluor secondary antibody, donkey-anti rabbit 568 (1
2000, Invitrogen, Paisley, UK) and donkey anti-mouse 568 (1
2000, Invitrogen, Paisley, UK). Negative controls were done for all the above where the primary antibody was omitted.
Quantitative Real-time Polymerase Chain Reaction
RNA was extracted using TRIzol reagent (Sigma Aldrich, Dorset, UK) from whole eye cups after the removal of extra-ocular tissue, cornea, lens and ciliary body/iris. The RNA was reverse transcribed using a Qiagen QuantiTect Kit and qPCR was performed using Power SYBR PCR master mix (Applied Biosystems, Paisley, UK) with the primer pairs; COX6B1 (Fwd: ACAATCTTTAGGAGTCAGGATGG, Rev: TTCTTAGTCTGGTTCTGGTTGG) and C3 (Fwd: GCGTAGTGATTGAGGATGGTG, Rev:ACAGTGACGGAGACATACAGG). Values were normalised using beta actin mRNA levels and analysed with DART-PCR software [29]. Each group consisted of 5 mice.
Western Blot
Anterior chambers were dissected out leaving the retina and RPE-choroidal tissues, which were immediately frozen in liquid nitrogen and stored at ?80°C. The tissues were homogenized in lysis buffer containing 4% sodium dodecyl sulfate, 17.5% glycerol, 0.25 M Tris and 100 mM DTT before extracts were electrophoretically separated on sodium dodecyl sulphate polyacrylamide gels. Subsequently, immunoblotted for COX (Abcam, Cambridge, UK) and tubulin (clone DM1A, Sigma Aldrich, Dorset, UK) as a housekeeping control protein. Changes of proteins were determined by densitometric scanning of immunoblots. Values were normalised to tubulin as loading control and averaged over at least 3 independent experiments [2], [30].
Analysis
Macrophage number, morphology and distribution
Fluorescence images of the complete RPE surface were captured using a Nikon DMX1200 digital camera (Tokyo, Japan) at a magnification of X400 and saved in JPEG format to count macrophages. The numbers of IBA-1 positive cells per eye were determined using the count tool on Adobe Photoshop CS6.
To analyze macrophage morphology, images were captured at X1000 of cells that were clearly well labelled but still representative of the population. More labelled macrophages were commonly found in central regions approximately 1 mm from the optic nerve head than in other areas. The diameters of the whole mounts were approximately 5 mm with approximately 50 cells in experimental animals and about 90 cells in controls. Within each retinae 9–12 individual cells were selected for analysis on the basis of morphological clarity and a separation of more than 75 µm from any other cells analyzed. Within such constraints candidate cells were identified by scanning across the RPE surface.
For every image the total number of primary dendritic processes on each macrophage was counted by drawing a 30 µm diameter circle around the soma and then counting the processes crossing the circle, as undertaken by Lee et al [30]. The same images were used to measure primary process length from the centre of the nucleus to the tip of each dendrite. Dendritic field size was also determined using the same image. For this, the longest axis of the dendritic field was measured and that of the field orthogonal to this and the mean length calculated. Lasso tool in Adobe Photoshop CS6 was used to measure the cell body area on the same cells [30]. The distance between adjacent macrophages was calculated from nucleus of each cell to its nearest neighbour [2]. For this the images were taken at a lower magnification of X400, as was undertaken to count macrophage numbers.
Quantifying immunostaining intensity
The methods used to quantify the intensity of the immunostaining were similar to those employed previously [2], [7], [30]. Sections used for analysis had relatively uniform staining patterns. Two regions in the central retina were selected for analysis on either side of the optic nerve head that were approximately 200 µm away from the optic nerve and 150 µm wide and captured at a magnification of X400 in JPEG format. Pixel intensity was calculated in Adobe Photoshop CS6, by using the lasso tool to draw a line. No less than 10 measurements per eye were taken. The regions of interest for immune staining varied depending on the marker as they accumulate at different locations. For COX, this was at the level of the photoreceptor inner segments. For C3 it was Bruch’s membrane and photoreceptor outer segments, while for vimentin and GFAP measurements were made across the full depth of the neural retina. A? was measured along Bruch’s membrane/RPE interface. For all immunostaining sections from experimental and control groups were stained on the same day and imaged with standard microscope settings. All data were analysed with GraphPad Prism 5 and statistical analysis was undertaken using Mann-Whitney U non parametric tests.
Results
670 nm Treatment Significantly Elevates COX Expression
COX is an enzyme in the mitochondrial respiratory chain which also functions as a photoacceptor molecule activated by long wavelengths [18], [25], [31]–[32]. COX immunostaining was present in both groups and was largely confined to mitochondrial rich regions, including photoreceptor inner segments and the outer plexiform layer (Figure 3A–D). There were significant differences between the two groups, in the experimental group COX expression was up regulated by approximately 50% (Figure 3E). To confirm the up regulation of COX following 670 nm treatment, quantitative Western blot and qPCR analysis were undertaken. These two independent methods confirmed similar significant increases with COX expression following light exposure (Figure 3F–H).
670 nm Treatment Significantly Changes Macrophage Morphology
IBA-1 is commonly used as a marker of macrophages. IBA-1 positive cells were widely distributed in a relatively uniform pattern over the RPE surface in both experimental and control groups, with somewhat more present in central than peripheral regions (Figure 4A–B). The morphology of the macrophages in the two groups appeared to be markedly different (Figure 4C–D) and although there were less stained cells in the light treated mice, this was not statistically significant (Figure 4E). However, the morphological differences between cells in the two groups were consistently significantly different over a range of metrics.
The primary processes in mice exposed to 670 nm light appeared to have wider bases and were significantly longer than those found in the control. In control mice mean primary process length was approximately 27 µm, while in experimental mice it almost doubled to approximately 54 µm (Figure 4F). Estimates for the area covered by the cells dendritic field between the two populations were consistent with this, as the longer processes in the 670 nm exposed mice covered a significantly larger area of the RPE surface (Figure 4G).
In the treated mice there was a significant increase in the distance between the cells from approximately 91 µm to approximately 151 µm (Figure 4H). Not only were the processes in treated mice longer, extending over a wider territory, but there were significantly more primary processes on them (Figure 4I). The relative expansion in the processes in 670 nm treated eyes was associated with a significant decline in the relative size of their cell bodies (Figure 4J). Hence, the dendritic architecture and size of individual macrophages in treated mice changed significantly in response to 670 nm light.
670 nm Treatment Reduces Outer Retinal Inflammation
The inflammatory marker C3 normally accumulates with age on Bruch’s membrane and on photoreceptor outer segments. C3 immunostaining was significantly lower in 670 nm treated mice at both locations than in controls (Figure 5A–D). On Bruch’s membrane it was almost halved, and on outer segments the reduction was approximately 20%. To confirm this finding C3 expression was also measured with qPCR, and again there was a significant reduction following 670 nm treatment with expression level halving (Figure 5E).
670 nm Treatment Reduces Retinal Stress
Retinal sections from the two groups were also stained for vimentin and GFAP. These are cytoskeletal intermediate filaments expressed in retinal Muller cells and are up regulated following retinal stress and ageing. Muller cell processes span the entire retina.
Staining was present for both vimentin and GFAP in both groups (Figure 6A–D, G–J). However expression of both was down regulated following 670 nm exposure. Vimentin labelling was much more extensive than GFAP in both experimental and control groups. With vimentin the number of Muller cell processes and their length were significantly reduced by 670 nm light (Figure 6E–F). In the untreated group (Figure 6C–D) labelling extended into the outer nuclear layer and was denser at the vitreal surface than in the treated mice. GFAP labelling was also significantly reduced following 670 nm light (Figure 6K), with more label present in the outer retina of controls (Figure 6I–J).
670 nm Treatment does not Alter Amyloid Beta Expression
With age, the outer retina accumulates A? mainly on Bruch’s membrane and on photoreceptor outer segments [2]. This age related deposit is pro-inflammatory. A? was measured on Bruch’s membrane in both experimental and control group (Figure 7A–B). Measurements of staining intensity made at this interface showed no difference in deposition between the two groups (Figure 7C).
Discussion
This study clearly shows that brief passive exposure to 670 nm light is effective in reducing inflammation in aged CFH?/? mice in which retinal pathology has become established [23]. The retina showed marked changes after 670 nm treatment, with a significant increase in COX expression and significant reductions in C3, vimetin and GFAP expression. Further, there were significant changes in the dendritic morphology and cell body size of sub-retinal macrophages, although there number did not decline significantly. These changes occur independent of A? load, which did not differ between the two groups.
These results are similar to those that we obtained using normal aged C57BL/6 mice where retinal inflammation had become established [7]. However, in previous studies animals were individually held in front of the light in an attempt to regulate exposure [7]. This study shows that 670 nm light impacts therapeutically irrespective of the method of delivery and can be delivered by supplementing this wavelength in normal light, where it is largely absent.
While it is clear that a range of inflammatory/stress markers are reduced by 670 nm light similar to that shown by Kokkinopoulos et al [7], we did not find a statistically significant decline in macrophage numbers as found in this earlier study. However, it was obvious with other metrics that 670 nm light had a profound impact on these cells by simple observation. Another factor that significantly reduces inflammation and impacts on macrophage morphology is vitamin D. Here the number of cells is significantly reduced along with age related outer retinal inflammation. Further, the morphology of these cells also changes, but here they develop larger cell bodies and have fewer processes [30]. It is likely that reducing macrophages will be beneficial in aged tissue, but changes in their morphology in response to different therapeutic routes may be difficult to compare directly.
These results sit firmly within an expanding data set from different laboratories, consistently revealing that 670 nm exposure has a significant impact on both pathology and ageing within diverse tissues [17], [18],[25], [33]–[39]. Given this diversity, the mechanism of action must act upon a fundamental aspect of cell function. With ageing and many forms of pathology, mitochondrial DNA is damaged and this probably reduces ATP output, which is critical for normal metabolic function. Changes in mitochondrial function are key to theories of ageing as the driving force for ageing probably relates to mitochondrial DNA damage reducing ATP and increasing ROS output, which is inflammatory and induces tissue degradation and cell loss [40]. The impact of such damage is marked in regions were metabolic rate is great, as in the outer retina[4]–[6]. Age related changes here not only include increased inflammation and deposition, but also the loss of approximately 25–30% of central photoreceptors in both man and mouse [13], [41].
The exact mechanism of 670 nm has not been proven. However it has been proposed that this wavelength is selectively absorbed by COX in mitochondria [42]. COX is the rate limiting enzyme in mitochondrial respiration, which we have shown is significantly up regulated following 670 nm exposure. Its activation enhances the efficiency of oxidative phosphorylation, which may in turn lead to an increase in ATP production and a reduction in ROS [17], [18], [37], [43], [44]. This in turn may reduce oxidative stress in the outer retina, which due to very high metabolic demand is particularly susceptible to this type of damage[4]–[6]. Whether this impacts on transcription factors and gene expression is unknown and there remains considerable speculation regarding these issues [31], [45]. However our current in vivo studies have confirmed that retinal ATP production declines with age and that 670 nm exposure corrects this.
Dosages of 670 nm vary between studies, although they tend to be relatively brief, but efficacy is common, indicating that the actual exposure levels required may be lower than had been expected. This is consistent with our data, as exposure levels must have varied between animals because they were often asleep through exposures, while at other times they were active but not necessarily oriented towards the source of the 670 nm light. In spite of this, because of the relatively long wavelength of 670 nm, it will penetrate deeply into the tissue. Consistent with this was the observation that the light from our delivery devices could be seen through the hand in a dimly lit room. Further, in a study this wavelength has been shown to reduce the pathology from partial section of the rat optic nerve when illumination was over the top of the head and only a very small amount of the light actually penetrated skull tissues [34]. Hence, 670 nm appears to be effective relatively independent of dosage or at least over a very wide range. However, we do not know a number of key variables, including how long following an exposure the impact of 670 nm remains effective, and also whether excess exposure ultimately has a negative impact or is ineffective. Resolution of these questions remains critically important in steps towards human therapeutic treatment.
In both normal ageing and in AMD outer retinal deposits and inflammation develop, partly due to the high metabolic demand of photoreceptors and the accumulation of relatively large quantities of extra-cellular debris, including A?, the heavier elements of which are pro-inflammatory [2], [26], [46]–[48]. However, here we demonstrate that it is possible to disassociate some of these factors by reducing markers of inflammation/stress independent of A? load. While there is little doubt that A? is toxic [49], [50], this is mainly true of the larger molecular forms, as the smaller elements are actually critical for synaptic plasticity and normal central nervous system function [51], [52]. Eventually, it is likely that progressive A? deposition on Bruch’s membrane will significantly compromise the permeability of this interface between the outer retina and its blood supply, which will probably impact negatively on outer retinal function. However, it is unclear to what extent such changes drive neuronal degeneration compared with inflammation alone. A key strategy in fighting retinal ageing is focussed on the issue of clearing A? systemically, which in turn is hoped to impact on inflammation. However, physiological levels of A? are necessary and their removal is likely to be detrimental with a loss of function [51], [52]. An alternative route that would avoid such problems may reside in the results of the study presented here.
Therapeutic routes in AMD have already been initiated using 670 nm light. While the patient numbers have been very low, they have shown significant improvements in terms of visual function in some using devices that were held directly in front of the eye [53]. While patient numbers need to be expanded and followed over long time periods, such results linked with this study and our previous work are encouraging.
Acknowledgments
The authors would like to thank Jaimie Hoh Kam, Vivian Lee for their help and Paul Johnson for modifications to animal cages.
Funding Statement
This study was funded by the Rosetrees Trust. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
53. Merry G, Dotson R, Devenyi R, Markowitz S, Reyes S (2012) Photobiomodulation as a New Treatment for Dry Age Related Macular Degeneration. Results from the Toronto and Oak Ridge Photobimodulation Study in AMD (TORPA), ARVO Meeting Abstracts 2012 53: 2049
Eur J Ophthalmol 2011; 00(00)
Article Type:
DOI:10.5301/EJO.2011.8175
T. Ivandic
Abstract
Photobiomodulation protects the retina from light-induced photoreceptor degeneration.
Author information
1Research School of Biology, National University, Canberra, Australia.
Abstract
PURPOSE:
In this study, the hypothesis that near-infrared (NIR) light treatment (photobiomodulation) attenuates bright-light damage in the albino rat retina was tested.
METHODS:
Young adult Sprague-Dawley (SD) albino rats were raised in dim (5 lux), cyclic light and then exposed to bright (1000 lux), continuous light for 24 hours. The animals were treated with 670-nm light (9 J/cm(2)) in an LED array before, during, or after exposure to light. The retinas were examined for function, structural changes, cell loss, and markers of stress and inflammation at 1 week and 1 month after exposure to damaging white light.
RESULTS:
Bright light caused photoreceptor-specific cell death in control retinas. Significant upregulation of stress and neuroprotective factors and the presence of activated microglia were also noted after light-induced damage. Photobiomodulation profoundly attenuated histopathologic alterations in all three treatment groups. NIR treatment also abolished microglial invasion of the retina and significantly reduced the presence of stress and neuroprotectant molecules. Bright-light-induced reductions in photoreceptor function were significantly ameliorated by photobiomodulation in animals treated before and during exposure to damaging light. Photoreceptor function was initially reduced in animals treated after bright-light-induced damage, but recovered by 1 month after exposure.
CONCLUSIONS:
NIR photobiomodulation is protective against bright-light-induced retinal degeneration, even when NIR treatment is applied after exposure to light. This protective effect appears to involve a reduction of cell death and inflammation. Photobiomodulation has the potential to become an important treatment modality for the prevention or treatment of light-induced stress in the retina. More generally, it could be beneficial in the prevention and treatment of retinal conditions involving inflammatory mechanisms.
Gene and noncoding RNA regulation underlying photoreceptor protection: microarray study of dietary antioxidant saffron and photobiomodulation in rat retina.
Author information
- 1Division of Biomedical Sciences & Biochemistry, Research School of Biology, Australian National University, Sydney, Australia. riccardo.natoli@anu.edu.au
Abstract
PURPOSE:
To identify the genes and noncoding RNAs (ncRNAs) involved in the neuroprotective actions of a dietary antioxidant (saffron) and of photobiomodulation (PBM).
METHODS:
We used a previously published assay of photoreceptor damage, in which albino Sprague Dawley rats raised in dim cyclic illumination (12 h 5 lux, 12 h darkness) were challenged by 24 h exposure to bright (1,000 lux) light. Experimental groups were protected against light damage by pretreatment with dietary saffron (1 mg/kg/day for 21 days) or PBM (9 J/cm(2) at the eye, daily for 5 days). RNA from one eye of four animals in each of the six experimental groups (control, light damage [LD], saffron, PBM, saffronLD, and PBMLD) was hybridized to Affymetrix rat genome ST arrays. Quantitative real-time PCR analysis of 14 selected genes was used to validate the microarray results.
RESULTS:
LD caused the regulation of 175 entities (genes and ncRNAs) beyond criterion levels (p<0.05 in comparison with controls, fold-change >2). PBM pretreatment reduced the expression of 126 of these 175 LD-regulated entities below criterion; saffron pretreatment reduced the expression of 53 entities (50 in common with PBM). In addition, PBM pretreatment regulated the expression of 67 entities not regulated by LD, while saffron pretreatment regulated 122 entities not regulated by LD (48 in common with PBM). PBM and saffron, given without LD, regulated genes and ncRNAs beyond criterion levels, but in lesser numbers than during their protective action. A high proportion of the entities regulated by LD (>90%) were known genes. By contrast, ncRNAs were prominent among the entities regulated by PBM and saffron in their neuroprotective roles (73% and 62%, respectively).
CONCLUSIONS:
Given alone, saffron and (more prominently) PBM both regulated significant numbers of genes and ncRNAs. Given before retinal exposure to damaging light, thus while exerting their neuroprotective action, they regulated much larger numbers of entities, among which ncRNAs were prominent. Further, the downregulation of known genes and of ncRNAs was prominent in the protective actions of both neuroprotectants. These comparisons provide an overview of gene expression induced by two neuroprotectants and provide a basis for the more focused study of their mechanisms.
Exp Eye Res. 2009 Nov;89(5):791-800. Epub 2009 Jul 16.
Low power laser treatment of the retina ameliorates neovascularisation in a transgenic mouse model of retinal neovascularisation.
Yu PK, Cringle SJ, McAllister IL, Yu DY.
Centre for Ophthalmology and Visual Science and the ARC Centre of Excellence in Vision Science, The University of Western Australia, 2 Verdun Street, Nedlands, Perth, Western Australia 6009, Australia. paulakyu@cyllene.uwa.edu.au
This study was designed to determine if low power laser therapy can achieve amelioration of vasoproliferation yet preserve useful vision in the treated area in a transgenic mouse model of retinal neovascularisation. The mice were anaesthetised and the pupils dilated for ERG and fundus fluorescein angiography on postnatal day 32. The left eyes were treated with approximately 85 laser spots (532 nm, 50 ms, 300 microm diameter) at a power level of 20 mW at the cornea. The eyes were examined using ERG and fluorescein angiography, one, four and six weeks later. Flat mounts of FITC-dextran infused retinas, retinal histology and PEDF immunohistochemistry was studied one or six weeks after laser treatment. In untreated eyes the expected course of retinal neovascularisation in this model was observed. However, retinal neovascularisation in the laser treated eye was significantly reduced. The laser parameters chosen produced only mild lesions which took 10-20 s to become visible. ERG responses were comparable between the treated and untreated eyes, and histology showed only partial loss of photoreceptors in the treated eyes. PEDF intensity corresponded inversely with the extent of neovascularisation. Low power panretinal photocoagulation can inhibit retinal neovascularisation and yet preserve partial visual function in this transgenic mouse model of retinal neovascularisation.
Photomed Laser Surg. 2008 Jun;26(3):241-5
Low-level laser therapy improves vision in patients with age-related macular degeneration.
Ivandic BT, Ivandic T.
University of Heidelberg, Otto-Meyerhof Centre, Heidelberg.
Abstract Objective: The objective of this study of a case series was to examine the effects of low-level laser therapy (LLLT) in patients with age-related macular degeneration (AMD).
Background Data: AMD affects a large proportion of the elderly population; current therapeutic options for AMD are limited, however. Patients and Methods: In total, 203 patients (90 men and 113 women; mean age 63.4 +/- 5.3 y) with beginning (“dry”) or advanced (“wet”) forms of AMD (n = 348 eyes) were included in the study. One hundred ninety-three patients (mean age 64.6 +/- 4.3 y; n = 328 eyes) with cataracts (n = 182 eyes) or without cataracts (n = 146 eyes) were treated using LLLT four times (twice per week). A semiconductor laser diode (780 nm, 7.5 mW, 292 Hz, continuous emission) was used for transconjunctival irradiation of the macula for 40 sec (0.3 J/cm(2)) resulting in a total dose of 1.2 J/cm(2). Ten patients (n = 20 eyes) with AMD received mock treatment and served as controls. Visual acuity was measured at each visit. Data were analyzed retrospectively using a t-test.
Results: LLLT significantly improved visual acuity (p < 0.00001 versus baseline) in 162/182 (95%) of eyes with cataracts and 142/146 (97%) of eyes without cataracts. The prevalence of metamorphopsia, scotoma, and dyschromatopsia was reduced. In patients with wet AMD, edema and bleeding improved. The improved vision was maintained for 3-36 mo after treatment. Visual acuity in the control group remained unchanged. No adverse effects were observed in those undergoing therapy.
Conclusion: In patients with AMD, LLLT significantly improved visual acuity without adverse side effects and may thus help to prevent loss of vision
Retina. 2008 Apr;28(4):615-21.
Large-spot subthreshold infrared laser to treat diabetic macular edema.
Squirrell DM, Stewart AW, Joondeph BC, Danesh-Meyer HV, McGhee CN, Donaldson ML.
Department of Ophthalmology, Royal Hallamshire Hospital, Sheffield, United Kingdom. David.Squirrell@sth.nhs.uk
PURPOSE: To evaluate the efficacy of a large-spot subthreshold infrared laser protocol to treat diabetic maculopathy.
METHODS: In a prospective, fellow eye, controlled case series, all patients had clinically significant diabetic macular edema (DME) treated with a single application of subthreshold infrared (810 nm) laser. If bilateral disease was present, the fellow eye was treated with conventional macular laser. The study was to include 20 patients. Visual acuity and central macular thickness (CMT) measured by optical coherence tomography (OCT) were assessed in the study and fellow eyes at baseline and 6 months, and any changes were compared.
RESULTS: The 11th patient developed a choroidal infarct with subsequent profound loss of vision immediately after treatment. The study was terminated prematurely at this point. For the remaining 10 patients, there was a trend toward improvement in visual acuity in the study eye compared with the fellow eye at the 6-month follow-up (median change: +1.5 letters for study eye vs -6.5 letters for fellow eye; P = 0.08). There was also significant improvement in OCT-measured CMT in the study eye (mean decrease, 117 microm) compared with deterioration in OCT-measured CMT in the fellow eye (mean increase, 24 microm; P = 0.02).
CONCLUSION: This subthreshold infrared laser protocol led to improvement in OCT-measured CMT and stabilization of vision in most subjects. The current protocol is however unpredictable and should not be used in the treatment of DME without further modification.
Neuroprotection in the juvenile rat model of light-induced retinopathy: evidence suggesting a role for FGF-2 and CNTF.
Author information
- 1Departments of Biological Sciences, University of Montreal, Quebec, Canada.
Abstract
PURPOSE:
In a former study, it was demonstrated that the retina of juvenile Sprague-Dawley (SD) rat has a remarkable intrinsic resistance to light-induced retinopathy compared with the adult retina. The purpose of the present study was to investigate the cellular and molecular mechanisms underlying this endogenous resistance to light-induced damage.
METHODS:
Juvenile SD rats were exposed for 6 (from P14 to P20) or 14 (from P14 to P28) days to a bright, cyclic, luminous environment of 10,000 lux. Retinal histology was examined immediately after exposure to light or at 2 months of age, and photoreceptor cell death was quantified by measuring the thickness of the outer nuclear layer (ONL) and by TUNEL assays. Changes in protein levels and cellular localization of fibroblast growth factor (FGF)-2, ciliary neurotrophic factor (CNTF), and brain-derived neurotrophic factor (BDNF) were determined by Western blot analysis and retinal immunohistochemistry, respectively.
RESULTS:
The data demonstrate that although the rate of photoreceptor loss was different after 6 and 14 days of exposure to light, similar ONL thickness was reached at 2 months of age–that is, 4 to 5 weeks after exposure to light. A large number of TUNEL-positive photoreceptors was visualized immediately after 6 and 14 days of exposure to light, reflecting the intense cell death that was occurring in the ONL. Western blot analysis showed that exposure to light induced a strong upregulation of the neurotrophic factors FGF-2 and CNTF in juvenile retinas, whereas no change in BDNF protein expression was noted. Of interest, after exposure to light, endogenous FGF-2 and CNTF were selectively upregulated in Müller cells.
CONCLUSIONS:
The results show that endogenous expression of FGF-2 and CNTF by Müller glia may play a role in protecting the juvenile retina from light-induced damage.
Ophthalmology. 2006 Dec;113(12):2237-42. Epub 2006 Sep 25.
Subthreshold grid laser treatment of macular edema secondary to branch retinal vein occlusion with micropulse infrared (810 nanometer) diode laser.
Parodi MB, Spasse S, Iacono P, Di Stefano G, Canziani T, Ravalico G.
Eye Clinic, Azienda Ospedaliero-Universitaria di Trieste, Trieste, Italy. maubp@yahoo.it
PURPOSE: To compare the effectiveness of subthreshold grid laser treatment (SGLT) with an infrared micropulse diode laser with that of threshold grid laser treatment (TGLT) for macular edema secondary to branch retinal vein occlusion (BRVO).
DESIGN: Randomized clinical trial.
PARTICIPANTS: Thirty-six patients (36 eyes) were randomized either to infrared SGLT (17 eyes) or to krypton TGLT (19 eyes).
METHODS: Complete ophthalmic examinations, including determination of visual acuity (VA) with Early Treatment Diabetic Retinopathy Study charts, optical coherence tomography (OCT), and fluorescein angiography, were performed at the time of the study entry and at 6-month intervals, with a planned follow-up of 24 months.
MAIN OUTCOME MEASURES: Primary: decrease in mean foveal thickness (FT) on OCT. Secondary: changes of the total macular volume (TMV) over the follow-up, proportion of eyes that gained at least 10 letters (approximately > or =2 lines of VA gain) at the 12- and 24-month examinations, and timing of macular edema resolution.
RESULTS: Changes in mean FT and TMV from the initial values were statistically significant for TGLT from the 6-month examination (P<0.001) and for SGLT from the 12-month examination (P<0.001). After 1 year, there was no difference in mean FT and TMV between the 2 groups. At the 12-month examination, 10 patients of the SGLT group (59%) and 11 of the TGLT group (58%) gained at least 10 letters (2 lines) in VA. At the 24-month examination, this gain was achieved by 11 patients (65%) of the SGLT group and 11 (58%) of the TGLT group. Moreover, at the 24-month examination 59% and 26% gained 3 lines in the SGLT and TGLT groups, respectively.
CONCLUSIONS: Resolution of macular edema and VA improvement are similar to those obtained with conventional TGLT, but SGLT is not associated with biomicroscopic and angiographic signs. A multicenter randomized clinical trial would be needed to ascertain the real efficacy and the most appropriate settings of SGLT for macular edema secondary to BRVO.
Photomed Laser Surg. 2006 Apr;24(2):121-8.
Clinical and experimental applications of NIR-LED photobiomodulation.
Desmet KD, Paz DA, Corry JJ, Eells JT, Wong-Riley MT, Henry MM, Buchmann EV, Connelly MP, Dovi JV, Liang HL, Henshel DS, Yeager RL, Millsap DS, Lim J, Gould LJ, Das R, Jett M, Hodgson BD, Margolis D, Whelan HT.
Department of Clinical Laboratory Sciences, University of Wisconsin-Milwaukee, 53226, USA.
This review presents current research on the use of far-red to near-infrared (NIR) light treatment in various in vitro and in vivo models. Low-intensity light therapy, commonly referred to as “photobiomodulation,” uses light in the far-red to near-infrared region of the spectrum (630-1000 nm) and modulates numerous cellular functions. Positive effects of NIR-light-emitting diode (LED) light treatment include acceleration of wound healing, improved recovery from ischemic injury of the heart, and attenuated degeneration of injured optic nerves by improving mitochondrial energy metabolism and production. Various in vitro and in vivo models of mitochondrial dysfunction were treated with a variety of wavelengths of NIR-LED light. These studies were performed to determine the effect of NIR-LED light treatment on physiologic and pathologic processes. NIRLED light treatment stimulates the photoacceptor cytochrome c oxidase, resulting in increased energy metabolism and production. NIR-LED light treatment accelerates wound healing in ischemic rat and murine diabetic wound healing models, attenuates the retinotoxic effects of methanol-derived formic acid in rat models, and attenuates the developmental toxicity of dioxin in chicken embryos. Furthermore, NIR-LED light treatment prevents the development of oral mucositis in pediatric bone marrow transplant patients. The experimental results demonstrate that NIR-LED light treatment stimulates mitochondrial oxidative metabolism in vitro, and accelerates cell and tissue repair in vivo. NIR-LED light represents a novel, noninvasive, therapeutic intervention for the treatment of numerous diseases linked to mitochondrial dysfunction.
Vestn Oftalmol. 2004 Nov-Dec;120(6):5-8. |
Dependence of the efficiency of low-intensity laser therapy in involution chorioretinal dystrophy on a used wavelength
[Article in Russian]
Abramov MV, Egorov EA.
Seventy-five patients (75 eyes) with central involution chorioretinal dystrophy (non-exudative type at the progression stage) were followed up. All of them received low-intensity laser therapy. Irradiation of 890 nm, 644 nm and 500 nm was used in groups 1, 2 and 3, respectively. The study purpose was to compare the efficiency of wavelengths. Visual acuity and retinal sensitivity were determined. The results were evaluated immediately after treatment and in 3 months. The maximal improvement in visual acuity and retinal sensitivity was in those who received 890 nm laser therapy; 500 nm irradiation–a less pronounced effect and 640 nm–the lowest one. We attribute such distribution of efficiency to a proliferation type of each irradiation range in the macular zone.
Mitochondrion. 2004 Sep;4(5-6):559-67.
Mitochondrial signal transduction in accelerated wound and retinal healing by near-infrared light therapy.
Eells JT, Wong-Riley MT, VerHoeve J, Henry M, Buchman EV, Kane MP, Gould LJ, Das R, Jett M, Hodgson BD, Margolis D, Whelan HT.
Department of Health Sciences, College of Health Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53201, USA. jeells@uwm.edu
Photobiomodulation by light in the red to near infrared range (630-1000 nm) using low energy lasers or light-emitting diode (LED) arrays has been shown to accelerate wound healing, improve recovery from ischemic injury in the heart and attenuate degeneration in the injured optic nerve. Recent evidence indicates that the therapeutic effects of red to near infrared light result, in part, from intracellular signaling mechanisms triggered by the interaction of NIR light with the mitochondrial photoacceptor molecule cytochrome c oxidase. We have demonstrated that NIR-LED photo-irradiation increases the production of cytochrome oxidase in cultured primary neurons and reverses the reduction of cytochrome oxidase activity produced by metabolic inhibitors. We have also shown that NIR-LED treatment prevents the development of oral mucositis in pediatric bone marrow transplant patients. Photobiomodulation improves wound healing in genetically diabetic mice by upregulating genes important in the promotion of wound healing. More recent studies have provided evidence for the therapeutic benefit of NIR-LED treatment in the survival and functional recovery of the retina and optic nerve in vivo after acute injury by the mitochondrial toxin, formic acid generated in the course of methanol intoxication. Gene discovery studies conducted using microarray technology documented a significant upregulation of gene expression in pathways involved in mitochondrial energy production and antioxidant cellular protection. These findings provide a link between the actions of red to near infrared light on mitochondrial oxidative metabolism in vitro and cell injury in vivo. Based on these findings and the strong evidence that mitochondrial dysfunction is involved in the pathogenesis of numerous diseases processes, we propose that NIR-LED photobiomodulation represents an innovative and non-invasive therapeutic approach for the treatment of tissue injury and disease processes in which mitochondrial dysfunction is postulated to play a role including diabetic retinopathy, age-related macular degeneration, Leber’s hereditary optic neuropathy and Parkinson’s disease.
Proc Natl Acad Sci U S A. 2003 Mar 18;100(6):3439-44. Epub 2003 Mar 7.
Therapeutic photobiomodulation for methanol-induced retinal toxicity.
Eells JT, Henry MM, Summerfelt P, Wong-Riley MT, Buchmann EV, Kane M, Whelan NT, Whelan HT.
Department of Pharmacology and Toxicology, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226, USA. jeells@mcw.edu
Methanol intoxication produces toxic injury to the retina and optic nerve, resulting in blindness. The toxic metabolite in methanol intoxication is formic acid, a mitochondrial toxin known to inhibit the essential mitochondrial enzyme, cytochrome oxidase. Photobiomodulation by red to near-IR radiation has been demonstrated to enhance mitochondrial activity and promote cell survival in vitro by stimulation of cytochrome oxidase activity. The present studies were undertaken to test the hypothesis that exposure to monochromatic red radiation from light-emitting diode (LED) arrays would protect the retina against the toxic actions of methanol-derived formic acid in a rodent model of methanol toxicity. Using the electroretinogram as a sensitive indicator of retinal function, we demonstrated that three brief (2 min, 24 s) 670-nm LED treatments (4 J/cm(2)), delivered at 5, 25, and 50 h of methanol intoxication, attenuated the retinotoxic effects of methanol-derived formate. Our studies document a significant recovery of rod- and cone-mediated function in LED-treated, methanol-intoxicated rats. We further show that LED treatment protected the retina from the histopathologic changes induced by methanol-derived formate. These findings provide a link between the actions of monochromatic red to near-IR light on mitochondrial oxidative metabolism in vitro and retinoprotection in vivo. They also suggest that photobiomodulation may enhance recovery from retinal injury and other ocular diseases in which mitochondrial dysfunction is postulated to play a role.
Ophthalmology. 1999 Nov;106(11):2082-90.
Therapeutic benefits of infrared (810-nm) diode laser macular grid photocoagulation in prophylactic treatment of nonexudative age-related macular degeneration: two-year results of a randomized pilot study.
Olk RJ, Friberg TR, Stickney KL, Akduman L, Wong KL, Chen MC, Levy MH, Garcia CA, Morse LS.
The Retina Center of St. Louis Co., Missouri 63141, USA.
OBJECTIVE: This pilot study collected preliminary information on the effectiveness and safety of infrared (810-nm) diode laser macular grid photocoagulation in patients with nonexudative age-related macular degeneration (AMD). Results from this pilot study were used in designing a larger, multicenter, randomized clinical trial.
DESIGN: A multicenter, randomized, controlled, clinical trial.
PARTICIPANTS: A total of 229 eyes of 152 patients with AMD were enrolled in the pilot study. Seventy-five patients with 1 eye eligible (75 eyes) were enrolled in the unilateral arm of the study; 77 patients with both eyes eligible (154 eyes) were enrolled in the bilateral arm of the study. In the unilateral study arm, 32 eyes were randomized to the observation group, 27 eyes were treated with visible endpoint burns, and 16 eyes were treated with invisible endpoint (subthreshold) lesions. In the bilateral study arm, 77 eyes were in the observation group, 36 eyes were treated with visible burns, and 41 eyes were treated with subthreshold (invisible) lesions.
INTERVENTION: Eyes were treated with infrared (810-nm) diode laser macular grid photocoagulation using either visible burns or subthreshold (invisible) lesions and compared to eyes receiving no treatment.
MAIN OUTCOME MEASURES: Reduction of drusen, change in visual acuity, and rate of choroidal neovascularization (CNV) membrane formation.
RESULTS: At 12 months after treatment, 62% of eyes treated with visible burns had a clinically significant reduction in drusen, whereas this proportion (65%) was reached in 18 months for eyes treated with subthreshold lesions. At 24 months’ follow-up, treated eyes had a significant reduction in drusen compared to observation eyes (P < 0.0001). Visual acuity was significantly improved in treated eyes at 12, 18, and 24 months compared to observation eyes (P < 0.001). Choroidal neovascularization formation was similar in treated and observation eyes through 24 months’ follow-up. Complications included CNV associated with six eyes treated with visible burns and a juxtafoveal laser scar in one eye treated with visible burns.
CONCLUSIONS: Infrared (810-nm) diode laser macular grid photocoagulation in patients with nonexudative AMD significantly reduces drusen levels (P < 0.0001) and significantly improves visual acuity (P < 0.001) when either visible endpoint burns or subthreshold endpoint lesions are used. Complications were fewer using subthreshold endpoint lesions. A larger, multicenter, prospective clinical trial with longer follow-up is needed to determine the efficacy of treatment in reducing the rate of CNV formation. Data from this clinical pilot study have been used to design the Prophylactic Treatment of AMD Trial (PTAMD), a multicenter, randomized, prospective clinical trial currently in progress comparing subthreshold (invisible) treatment to observation in eyes with nonexudative AMD.
Ophthalmology. 1997 Dec;104(12):2030-8.
The treatment of macular disease using a micropulsed and continuous wave 810 nm diode laser.
Friberg TR, Karatza EC.
Eye and Ear Institute and the Department of Ophthalmology, University of Pittsburgh School of Medicine, Pennsylvania 15213, USA.
OBJECTIVE: The purpose of the study is to determine whether the 810-nm diode wavelength using a rectangular waveform is clinically effective in the treatment of choroidal neovascularization from age-related macular degeneration and to determine whether macular edema secondary to branch vein occlusion or diabetic retinopathy can be effectively treated with this laser using the micropulse waveform.
DESIGN: Review of consecutive nonrandomized patients whose eyes were treated with the diode laser over a 30-month period.
PARTICIPANTS: Fifty-three patients with an initial presentation of choroidal neovascularization located subfoveally (77%), extrafoveally (17%), and juxtafoveally (6%); 14 patients with macular edema from a branch vein occlusion; and 59 patients with diabetic macular edema, 40 of which were treated for the first time.
INTERVENTION: Ablative rectangular wave laser photocoagulation was applied to the choroidal neovascular membranes and very light threshold treatment was applied in a macular grid to treat retinal edema. Microaneurysms were not targeted.
MAIN OUTCOME MEASURES: Anatomic resolution of macular edema or choroidal neovascularization and visual acuity.
RESULTS: Sixty percent of eyes treated for choroidal neovascularization had no persistence or recurrence at 6 months, and 72% achieved visual stabilization. In 8% of eyes, some localized bleeding occurred during photocoagulation. Clinical resolution of macular edema from branch vein occlusion occurred by 6 months in 92% of eyes, and 77% had stabilization of visual acuity. At 6 months, 76% of newly treated patients with diabetic macular edema and 67% of previously treated patients had clinical resolution of their edema. Vision was improved or stabilized in 91% and 73% of newly treated and retreated patients at 6 months, respectively. CONCLUSIONS: The micropulsed 810-nm diode laser is clinically effective in the treatment of macular edema from venous occlusion and diabetic retinopathy, and the rectangular (normal) mode diode laser can be used in many eyes with choroidal neovascularization.
Vestn Oftalmol. 1997 Nov-Dec;113(6):17-9.
New method of atherosclerotic macular dystrophies treatment.
[Article in Russian]
Basinskii SN, Krasnogorskaia VN.
The authors analyze the results of treating atherosclerotic maculodystrophies by direct laser phoresis. The method consists in insertion of a collagen infusion system in Tenon’s space. Drugs (nicotinic acid or xanthinol nicotinate) are delivered to the posterior compartment of the eye through this system. Then a light guide is inserted in the tube and a 2-min session of low-intensity He-Ne laser exposure is performed at a wavelength of 630 nm, and 10 mWt/cm2 flow power density (7 to 10 sessions per course). Clinical studies showed that vision acuity increased by an average of 0.08 diopters, or by 40% of the initial level, in 72% of cases. The peripheral visual field extended by an average of 51.4 degrees for 8 meridians in 95% of patients. The index of critical frequency of flashings fusing and the frequency-contrast characteristics improved in 85% of cases. The rheography improved by 34.5% of the initial level. A stable improvement was observed for 12 months after a course of direct laser phoresis in 97.5% of patients. Hence, the new method is simple and recommended for the treatment of atherosclerotic maculodystrophies.